Incidental Mutation 'R7402:Obsl1'
ID574217
Institutional Source Beutler Lab
Gene Symbol Obsl1
Ensembl Gene ENSMUSG00000026211
Gene Nameobscurin-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R7402 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location75479310-75506452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75487704 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1653 (T1653A)
Ref Sequence ENSEMBL: ENSMUSP00000109197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050899] [ENSMUST00000113567] [ENSMUST00000113575]
Predicted Effect probably benign
Transcript: ENSMUST00000050899
SMART Domains Protein: ENSMUSP00000057865
Gene: ENSMUSG00000051703

DomainStartEndE-ValueType
Pfam:DUF4203 40 236 7.2e-51 PFAM
low complexity region 252 302 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113567
AA Change: T1653A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109197
Gene: ENSMUSG00000026211
AA Change: T1653A

DomainStartEndE-ValueType
IGc2 24 91 1.23e-12 SMART
IGc2 140 216 2.33e-13 SMART
IGc2 258 326 1.48e-6 SMART
IG 347 427 9.49e-5 SMART
IG 435 511 1.04e-1 SMART
FN3 518 601 6.6e-2 SMART
PDB:2E6Q|A 608 714 8e-57 PDB
Blast:IG_like 622 711 3e-50 BLAST
IG 723 804 3.79e-4 SMART
IG 814 893 2.58e-6 SMART
IGc2 911 977 1.12e-6 SMART
IG 996 1075 1.27e-5 SMART
IGc2 1094 1160 4.07e-4 SMART
IGc2 1186 1252 9.49e-5 SMART
IG 1274 1353 7.41e-7 SMART
IG 1363 1444 1.15e-3 SMART
IG 1454 1533 8.33e-1 SMART
IGc2 1549 1615 8.72e-4 SMART
IG 1633 1712 1e-3 SMART
IG 1723 1802 3.82e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113575
SMART Domains Protein: ENSMUSP00000109205
Gene: ENSMUSG00000051703

DomainStartEndE-ValueType
Pfam:DUF4203 39 237 2.2e-59 PFAM
low complexity region 252 302 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132252
SMART Domains Protein: ENSMUSP00000117420
Gene: ENSMUSG00000026211

DomainStartEndE-ValueType
IG_like 1 59 2.8e-1 SMART
IGc2 85 151 9.49e-5 SMART
IG 175 254 2.64e-3 SMART
IG 265 344 7.41e-7 SMART
Blast:IG 354 417 4e-35 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000155084
SMART Domains Protein: ENSMUSP00000114553
Gene: ENSMUSG00000026211

DomainStartEndE-ValueType
SCOP:d1g1ca_ 2 32 1e-3 SMART
IGc2 64 132 1.48e-6 SMART
IG 153 233 9.49e-5 SMART
IG 241 317 1.04e-1 SMART
FN3 324 407 6.6e-2 SMART
PDB:2E6Q|A 414 520 4e-57 PDB
Blast:IG_like 428 517 2e-50 BLAST
IG 529 610 3.79e-4 SMART
IG 620 699 2.58e-6 SMART
IGc2 717 783 1.12e-6 SMART
IG 802 881 1.27e-5 SMART
IGc2 900 966 4.07e-4 SMART
IGc2 992 1058 9.49e-5 SMART
IG 1080 1159 7.41e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 G T 14: 118,706,075 P12Q probably damaging Het
Acsf3 A G 8: 122,780,424 Y152C probably damaging Het
Adam22 T A 5: 8,095,049 Q803L possibly damaging Het
Adamtsl3 G A 7: 82,578,617 V1337I probably damaging Het
Adra1b T C 11: 43,776,018 D464G possibly damaging Het
Alpk3 T A 7: 81,076,912 I115K probably benign Het
Amdhd2 A G 17: 24,161,683 S96P Het
Ankib1 T G 5: 3,769,586 D111A probably benign Het
Arhgef2 A G 3: 88,633,566 D216G probably damaging Het
Astn1 A T 1: 158,552,855 probably benign Het
Atrn T A 2: 130,947,600 W328R probably damaging Het
Atxn7 A T 14: 14,095,427 H375L probably damaging Het
BC003331 A G 1: 150,386,356 probably null Het
Btaf1 A T 19: 37,003,515 N1579Y probably damaging Het
Cacna1b A T 2: 24,607,659 L2079Q probably benign Het
Ccdc102a T C 8: 94,903,353 K520R probably damaging Het
Cd2ap T C 17: 42,805,163 H602R possibly damaging Het
Cdkn2aip A G 8: 47,711,373 V435A possibly damaging Het
Cenpf A T 1: 189,659,378 Y735* probably null Het
Cep350 T A 1: 155,928,215 I1041L probably benign Het
Ckap4 A G 10: 84,527,999 V400A probably damaging Het
Comp T A 8: 70,377,204 D359E probably benign Het
Coq10b A C 1: 55,061,341 K61N probably benign Het
Csmd2 A C 4: 128,322,095 S548R Het
Csmd2 G A 4: 128,322,096 S548N Het
Ctif A G 18: 75,611,736 I99T probably benign Het
Ctns T G 11: 73,193,077 T40P possibly damaging Het
Cyp11b1 C T 15: 74,840,825 R129H probably damaging Het
Cyp2c68 A T 19: 39,740,874 N56K probably benign Het
D6Wsu163e A G 6: 126,962,005 K401R probably damaging Het
Dstn T A 2: 143,938,448 C23S probably benign Het
Fam214a C A 9: 75,006,386 Y107* probably null Het
Fam72a A T 1: 131,538,875 E132D probably damaging Het
Fam72a G T 1: 131,538,876 E133* probably null Het
Gbp8 T A 5: 105,031,295 I113F probably damaging Het
Gm3095 A T 14: 3,964,463 R60S possibly damaging Het
Gpa33 A T 1: 166,152,694 M109L probably damaging Het
Grik2 A G 10: 49,535,397 L215P probably damaging Het
Gucy2g A C 19: 55,206,293 F897L probably damaging Het
Hinfp A G 9: 44,298,017 L295P probably damaging Het
Ift122 T C 6: 115,894,322 V526A probably benign Het
Ighv5-12 T C 12: 113,702,233 T82A probably benign Het
Il18rap T A 1: 40,524,951 S76R probably benign Het
Itga6 A T 2: 71,853,553 N1045I probably benign Het
Kctd21 A T 7: 97,347,763 I148F possibly damaging Het
Kif28 T A 1: 179,740,079 H42L probably benign Het
Kmt2c A C 5: 25,395,420 C326W probably damaging Het
Knl1 T A 2: 119,095,226 L1912* probably null Het
Lrfn1 A T 7: 28,459,522 I289F probably damaging Het
Lrriq1 T C 10: 103,221,324 K205R possibly damaging Het
Mbd5 A T 2: 49,257,554 N592I probably damaging Het
Mbl2 A G 19: 30,239,402 N205D possibly damaging Het
Mcm4 C A 16: 15,637,178 M1I probably null Het
Mgat4a T A 1: 37,454,784 H327L probably damaging Het
Miox A G 15: 89,335,003 D16G probably benign Het
Mvk C A 5: 114,455,978 P298Q possibly damaging Het
Nol6 A G 4: 41,118,699 L726P probably damaging Het
Nos1 T C 5: 117,949,815 I1381T probably benign Het
Nup98 A T 7: 102,134,937 S1063T probably benign Het
Obscn T G 11: 58,995,449 M7862L unknown Het
Olfr1044 A G 2: 86,171,202 I205T probably benign Het
Olfr1202 G T 2: 88,817,343 M57I probably damaging Het
Olfr1497 C T 19: 13,794,994 V206I probably damaging Het
Olfr968 T A 9: 39,771,964 T279S probably benign Het
Pcdhb20 A G 18: 37,504,952 Y177C probably benign Het
Pcdhb3 A C 18: 37,301,604 I208L probably benign Het
Phlpp1 G T 1: 106,389,690 G1214W probably damaging Het
Ppp4r3a A T 12: 101,058,794 S149T possibly damaging Het
Pxdn T C 12: 30,002,439 C872R probably damaging Het
Rarb A G 14: 16,548,419 C101R probably damaging Het
Rcor3 A C 1: 192,127,983 V114G probably benign Het
Rnpepl1 A G 1: 92,919,650 Q653R probably benign Het
Rpap2 T A 5: 107,620,458 Y387* probably null Het
Rttn C T 18: 88,985,911 T343M possibly damaging Het
Samd11 T C 4: 156,248,773 T333A probably benign Het
Six5 T C 7: 19,095,043 L136P probably damaging Het
Slc12a5 T A 2: 164,982,932 M419K probably benign Het
Slc22a21 T C 11: 53,960,400 M179V probably benign Het
Slc35a4 A G 18: 36,680,517 D6G unknown Het
Spdye4c A T 2: 128,592,341 M1L probably benign Het
Svep1 A T 4: 58,069,699 C2696S possibly damaging Het
Tceanc2 T C 4: 107,147,696 N85S probably benign Het
Teddm2 A T 1: 153,850,597 L124Q probably damaging Het
Teddm2 G C 1: 153,850,598 L124V probably benign Het
Tgfbr1 T A 4: 47,405,623 W409R probably damaging Het
Tkt A G 14: 30,558,798 D62G probably damaging Het
Tnrc6b T A 15: 80,884,300 V1054D probably damaging Het
Trpm7 C A 2: 126,799,206 L1564F probably damaging Het
Vmn1r43 A T 6: 89,869,821 C228S probably benign Het
Vmn2r106 T C 17: 20,267,621 R839G probably damaging Het
Vmn2r5 G A 3: 64,495,755 T523I probably benign Het
Vwa3b C T 1: 37,114,597 Q507* probably null Het
Wrn C G 8: 33,248,966 W1278S probably benign Het
Zfp281 T G 1: 136,625,452 L56R probably damaging Het
Zfp407 G A 18: 84,561,536 T484I probably benign Het
Zfp451 T C 1: 33,813,762 T24A probably benign Het
Zfp607b T A 7: 27,693,494 F16I probably damaging Het
Zfp638 T A 6: 83,928,688 V41E possibly damaging Het
Other mutations in Obsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Obsl1 APN 1 75490874 missense probably benign 0.02
IGL01111:Obsl1 APN 1 75497145 missense possibly damaging 0.62
IGL01140:Obsl1 APN 1 75489756 unclassified probably benign
IGL02149:Obsl1 APN 1 75503820 missense probably damaging 1.00
IGL02225:Obsl1 APN 1 75503798 missense probably damaging 0.99
IGL02269:Obsl1 APN 1 75487713 missense probably damaging 0.97
IGL02296:Obsl1 APN 1 75498149 missense possibly damaging 0.94
IGL02386:Obsl1 APN 1 75492517 missense probably damaging 1.00
IGL02408:Obsl1 APN 1 75505246 missense probably damaging 0.98
IGL02601:Obsl1 APN 1 75489620 missense probably benign
IGL03053:Obsl1 APN 1 75493079 missense probably benign
IGL03181:Obsl1 APN 1 75492584 missense probably benign 0.00
IGL03402:Obsl1 APN 1 75486799 missense probably benign 0.00
PIT1430001:Obsl1 UTSW 1 75506167 missense probably damaging 1.00
PIT4382001:Obsl1 UTSW 1 75487963 missense probably benign 0.06
R0281:Obsl1 UTSW 1 75492927 missense probably damaging 1.00
R1343:Obsl1 UTSW 1 75492579 missense probably damaging 1.00
R1394:Obsl1 UTSW 1 75492665 missense probably damaging 0.96
R1395:Obsl1 UTSW 1 75492665 missense probably damaging 0.96
R1439:Obsl1 UTSW 1 75486784 nonsense probably null
R1456:Obsl1 UTSW 1 75487656 nonsense probably null
R1728:Obsl1 UTSW 1 75486756 missense probably benign
R1729:Obsl1 UTSW 1 75486756 missense probably benign
R1730:Obsl1 UTSW 1 75486756 missense probably benign
R1739:Obsl1 UTSW 1 75486756 missense probably benign
R1757:Obsl1 UTSW 1 75493883 missense probably benign
R1762:Obsl1 UTSW 1 75486756 missense probably benign
R1783:Obsl1 UTSW 1 75486756 missense probably benign
R1784:Obsl1 UTSW 1 75486756 missense probably benign
R1785:Obsl1 UTSW 1 75486756 missense probably benign
R1851:Obsl1 UTSW 1 75492893 missense probably damaging 1.00
R1864:Obsl1 UTSW 1 75493109 missense probably benign 0.01
R1873:Obsl1 UTSW 1 75498233 missense probably damaging 1.00
R1875:Obsl1 UTSW 1 75498233 missense probably damaging 1.00
R1980:Obsl1 UTSW 1 75505836 missense probably damaging 1.00
R1985:Obsl1 UTSW 1 75505600 missense probably damaging 1.00
R2049:Obsl1 UTSW 1 75486756 missense probably benign
R2069:Obsl1 UTSW 1 75486756 missense probably benign
R2122:Obsl1 UTSW 1 75493883 missense probably benign
R2141:Obsl1 UTSW 1 75486756 missense probably benign
R2142:Obsl1 UTSW 1 75486756 missense probably benign
R2184:Obsl1 UTSW 1 75502217 missense probably benign 0.26
R2267:Obsl1 UTSW 1 75505698 missense probably damaging 1.00
R2883:Obsl1 UTSW 1 75496511 missense possibly damaging 0.73
R3079:Obsl1 UTSW 1 75490823 missense probably damaging 1.00
R3749:Obsl1 UTSW 1 75498246 missense probably benign
R4002:Obsl1 UTSW 1 75500099 missense possibly damaging 0.90
R4365:Obsl1 UTSW 1 75488049 missense possibly damaging 0.91
R4366:Obsl1 UTSW 1 75488049 missense possibly damaging 0.91
R4414:Obsl1 UTSW 1 75490902 missense probably benign 0.00
R4700:Obsl1 UTSW 1 75503441 missense probably damaging 1.00
R4799:Obsl1 UTSW 1 75489501 missense possibly damaging 0.93
R5081:Obsl1 UTSW 1 75487963 missense possibly damaging 0.49
R5389:Obsl1 UTSW 1 75503261 intron probably benign
R5757:Obsl1 UTSW 1 75493055 missense probably damaging 0.98
R5890:Obsl1 UTSW 1 75493859 missense probably damaging 1.00
R5946:Obsl1 UTSW 1 75491207 missense probably damaging 0.96
R6005:Obsl1 UTSW 1 75492215 splice site probably null
R6118:Obsl1 UTSW 1 75492078 intron probably benign
R6154:Obsl1 UTSW 1 75500144 missense probably benign 0.19
R6317:Obsl1 UTSW 1 75489629 missense possibly damaging 0.50
R6379:Obsl1 UTSW 1 75503143 missense probably damaging 1.00
R6387:Obsl1 UTSW 1 75491362 missense probably benign 0.03
R7084:Obsl1 UTSW 1 75487750 missense probably benign
R7123:Obsl1 UTSW 1 75489669 missense probably damaging 1.00
R7202:Obsl1 UTSW 1 75489716 missense possibly damaging 0.94
R7291:Obsl1 UTSW 1 75489517 missense probably damaging 0.98
R7305:Obsl1 UTSW 1 75493946 nonsense probably null
R7366:Obsl1 UTSW 1 75502964 missense probably damaging 1.00
R7474:Obsl1 UTSW 1 75498184 missense probably benign 0.00
R7611:Obsl1 UTSW 1 75505380 missense probably damaging 0.96
R7672:Obsl1 UTSW 1 75492721 missense probably benign 0.18
R7715:Obsl1 UTSW 1 75502036 missense probably damaging 0.99
R7762:Obsl1 UTSW 1 75503523 missense probably benign
R8005:Obsl1 UTSW 1 75505452 missense probably damaging 1.00
R8012:Obsl1 UTSW 1 75492673 missense probably benign 0.12
R8379:Obsl1 UTSW 1 75503857 missense possibly damaging 0.92
R8381:Obsl1 UTSW 1 75503857 missense possibly damaging 0.92
R8383:Obsl1 UTSW 1 75503857 missense possibly damaging 0.92
R8396:Obsl1 UTSW 1 75503706 missense probably benign 0.01
R8465:Obsl1 UTSW 1 75503388 missense probably damaging 1.00
R8506:Obsl1 UTSW 1 75505656 missense probably benign 0.00
R8710:Obsl1 UTSW 1 75492682 missense probably benign
R8877:Obsl1 UTSW 1 75496523 nonsense probably null
R8903:Obsl1 UTSW 1 75487273 missense possibly damaging 0.65
R8913:Obsl1 UTSW 1 75491248 missense probably benign 0.00
R8924:Obsl1 UTSW 1 75506197 missense probably benign 0.00
R8955:Obsl1 UTSW 1 75503849 missense probably damaging 1.00
V8831:Obsl1 UTSW 1 75486756 missense probably benign
X0061:Obsl1 UTSW 1 75486768 missense probably benign
Z1088:Obsl1 UTSW 1 75486756 missense probably benign
Z1176:Obsl1 UTSW 1 75486756 missense probably benign
Z1177:Obsl1 UTSW 1 75486756 missense probably benign
Z1177:Obsl1 UTSW 1 75491012 missense possibly damaging 0.95
Z1177:Obsl1 UTSW 1 75503792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGCAGAACTCAGAGCTGG -3'
(R):5'- TTTAACCCACTTCTAGGGAGGGG -3'

Sequencing Primer
(F):5'- CCGGGAGACACCAGCAGTAG -3'
(R):5'- CTTCTAGGGAGGGGGCGTG -3'
Posted On2019-09-13