Incidental Mutation 'R7402:Rcor3'
ID574231
Institutional Source Beutler Lab
Gene Symbol Rcor3
Ensembl Gene ENSMUSG00000037395
Gene NameREST corepressor 3
SynonymsE130101E15Rik, C730034D20Rik, 4921514E24Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.555) question?
Stock #R7402 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location192098546-192138062 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 192127983 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 114 (V114G)
Ref Sequence ENSEMBL: ENSMUSP00000106473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073279] [ENSMUST00000110849] [ENSMUST00000192128] [ENSMUST00000192158] [ENSMUST00000192491] [ENSMUST00000192866] [ENSMUST00000193144]
Predicted Effect unknown
Transcript: ENSMUST00000073279
AA Change: V114G
SMART Domains Protein: ENSMUSP00000073004
Gene: ENSMUSG00000037395
AA Change: V114G

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 3.89e-14 SMART
SANT 141 189 4.56e-8 SMART
low complexity region 349 363 N/A INTRINSIC
low complexity region 370 384 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110849
AA Change: V114G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000106473
Gene: ENSMUSG00000037395
AA Change: V114G

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 3.89e-14 SMART
SANT 141 189 4.56e-8 SMART
low complexity region 357 374 N/A INTRINSIC
low complexity region 397 413 N/A INTRINSIC
low complexity region 418 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192128
AA Change: V114G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141637
Gene: ENSMUSG00000037395
AA Change: V114G

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 1.8e-18 SMART
SANT 141 189 2.8e-10 SMART
coiled coil region 292 329 N/A INTRINSIC
SANT 342 390 7.5e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192158
SMART Domains Protein: ENSMUSP00000141841
Gene: ENSMUSG00000037395

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 98 6.6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192491
AA Change: V114G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141753
Gene: ENSMUSG00000037395
AA Change: V114G

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 1.8e-18 SMART
SANT 141 189 2.8e-10 SMART
coiled coil region 292 329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192866
AA Change: V114G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142054
Gene: ENSMUSG00000037395
AA Change: V114G

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 1.8e-18 SMART
SANT 141 189 2.8e-10 SMART
coiled coil region 292 329 N/A INTRINSIC
SANT 342 390 7.5e-13 SMART
low complexity region 449 463 N/A INTRINSIC
low complexity region 470 484 N/A INTRINSIC
low complexity region 498 514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193144
SMART Domains Protein: ENSMUSP00000142001
Gene: ENSMUSG00000037395

DomainStartEndE-ValueType
ELM2 1 54 1.8e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194750
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 G T 14: 118,706,075 P12Q probably damaging Het
Acsf3 A G 8: 122,780,424 Y152C probably damaging Het
Adam22 T A 5: 8,095,049 Q803L possibly damaging Het
Adamtsl3 G A 7: 82,578,617 V1337I probably damaging Het
Adra1b T C 11: 43,776,018 D464G possibly damaging Het
Alpk3 T A 7: 81,076,912 I115K probably benign Het
Amdhd2 A G 17: 24,161,683 S96P Het
Ankib1 T G 5: 3,769,586 D111A probably benign Het
Arhgef2 A G 3: 88,633,566 D216G probably damaging Het
Astn1 A T 1: 158,552,855 probably benign Het
Atrn T A 2: 130,947,600 W328R probably damaging Het
Atxn7 A T 14: 14,095,427 H375L probably damaging Het
BC003331 A G 1: 150,386,356 probably null Het
Btaf1 A T 19: 37,003,515 N1579Y probably damaging Het
Cacna1b A T 2: 24,607,659 L2079Q probably benign Het
Ccdc102a T C 8: 94,903,353 K520R probably damaging Het
Cd2ap T C 17: 42,805,163 H602R possibly damaging Het
Cdkn2aip A G 8: 47,711,373 V435A possibly damaging Het
Cenpf A T 1: 189,659,378 Y735* probably null Het
Cep350 T A 1: 155,928,215 I1041L probably benign Het
Ckap4 A G 10: 84,527,999 V400A probably damaging Het
Comp T A 8: 70,377,204 D359E probably benign Het
Coq10b A C 1: 55,061,341 K61N probably benign Het
Csmd2 A C 4: 128,322,095 S548R Het
Csmd2 G A 4: 128,322,096 S548N Het
Ctif A G 18: 75,611,736 I99T probably benign Het
Ctns T G 11: 73,193,077 T40P possibly damaging Het
Cyp11b1 C T 15: 74,840,825 R129H probably damaging Het
Cyp2c68 A T 19: 39,740,874 N56K probably benign Het
D6Wsu163e A G 6: 126,962,005 K401R probably damaging Het
Dstn T A 2: 143,938,448 C23S probably benign Het
Fam214a C A 9: 75,006,386 Y107* probably null Het
Fam72a A T 1: 131,538,875 E132D probably damaging Het
Fam72a G T 1: 131,538,876 E133* probably null Het
Gbp8 T A 5: 105,031,295 I113F probably damaging Het
Gm3095 A T 14: 3,964,463 R60S possibly damaging Het
Gpa33 A T 1: 166,152,694 M109L probably damaging Het
Grik2 A G 10: 49,535,397 L215P probably damaging Het
Gucy2g A C 19: 55,206,293 F897L probably damaging Het
Hinfp A G 9: 44,298,017 L295P probably damaging Het
Ift122 T C 6: 115,894,322 V526A probably benign Het
Ighv5-12 T C 12: 113,702,233 T82A probably benign Het
Il18rap T A 1: 40,524,951 S76R probably benign Het
Itga6 A T 2: 71,853,553 N1045I probably benign Het
Kctd21 A T 7: 97,347,763 I148F possibly damaging Het
Kif28 T A 1: 179,740,079 H42L probably benign Het
Kmt2c A C 5: 25,395,420 C326W probably damaging Het
Knl1 T A 2: 119,095,226 L1912* probably null Het
Lrfn1 A T 7: 28,459,522 I289F probably damaging Het
Lrriq1 T C 10: 103,221,324 K205R possibly damaging Het
Mbd5 A T 2: 49,257,554 N592I probably damaging Het
Mbl2 A G 19: 30,239,402 N205D possibly damaging Het
Mcm4 C A 16: 15,637,178 M1I probably null Het
Mgat4a T A 1: 37,454,784 H327L probably damaging Het
Miox A G 15: 89,335,003 D16G probably benign Het
Mvk C A 5: 114,455,978 P298Q possibly damaging Het
Nol6 A G 4: 41,118,699 L726P probably damaging Het
Nos1 T C 5: 117,949,815 I1381T probably benign Het
Nup98 A T 7: 102,134,937 S1063T probably benign Het
Obscn T G 11: 58,995,449 M7862L unknown Het
Obsl1 T C 1: 75,487,704 T1653A probably benign Het
Olfr1044 A G 2: 86,171,202 I205T probably benign Het
Olfr1202 G T 2: 88,817,343 M57I probably damaging Het
Olfr1497 C T 19: 13,794,994 V206I probably damaging Het
Olfr968 T A 9: 39,771,964 T279S probably benign Het
Pcdhb20 A G 18: 37,504,952 Y177C probably benign Het
Pcdhb3 A C 18: 37,301,604 I208L probably benign Het
Phlpp1 G T 1: 106,389,690 G1214W probably damaging Het
Ppp4r3a A T 12: 101,058,794 S149T possibly damaging Het
Pxdn T C 12: 30,002,439 C872R probably damaging Het
Rarb A G 14: 16,548,419 C101R probably damaging Het
Rnpepl1 A G 1: 92,919,650 Q653R probably benign Het
Rpap2 T A 5: 107,620,458 Y387* probably null Het
Rttn C T 18: 88,985,911 T343M possibly damaging Het
Samd11 T C 4: 156,248,773 T333A probably benign Het
Six5 T C 7: 19,095,043 L136P probably damaging Het
Slc12a5 T A 2: 164,982,932 M419K probably benign Het
Slc22a21 T C 11: 53,960,400 M179V probably benign Het
Slc35a4 A G 18: 36,680,517 D6G unknown Het
Spdye4c A T 2: 128,592,341 M1L probably benign Het
Svep1 A T 4: 58,069,699 C2696S possibly damaging Het
Tceanc2 T C 4: 107,147,696 N85S probably benign Het
Teddm2 A T 1: 153,850,597 L124Q probably damaging Het
Teddm2 G C 1: 153,850,598 L124V probably benign Het
Tgfbr1 T A 4: 47,405,623 W409R probably damaging Het
Tkt A G 14: 30,558,798 D62G probably damaging Het
Tnrc6b T A 15: 80,884,300 V1054D probably damaging Het
Trpm7 C A 2: 126,799,206 L1564F probably damaging Het
Vmn1r43 A T 6: 89,869,821 C228S probably benign Het
Vmn2r106 T C 17: 20,267,621 R839G probably damaging Het
Vmn2r5 G A 3: 64,495,755 T523I probably benign Het
Vwa3b C T 1: 37,114,597 Q507* probably null Het
Wrn C G 8: 33,248,966 W1278S probably benign Het
Zfp281 T G 1: 136,625,452 L56R probably damaging Het
Zfp407 G A 18: 84,561,536 T484I probably benign Het
Zfp451 T C 1: 33,813,762 T24A probably benign Het
Zfp607b T A 7: 27,693,494 F16I probably damaging Het
Zfp638 T A 6: 83,928,688 V41E possibly damaging Het
Other mutations in Rcor3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Rcor3 APN 1 192127971 unclassified probably benign
IGL01688:Rcor3 APN 1 192123600 missense probably damaging 1.00
IGL01905:Rcor3 APN 1 192101002 missense probably damaging 1.00
R0523:Rcor3 UTSW 1 192130436 missense probably damaging 1.00
R1305:Rcor3 UTSW 1 192116346 missense possibly damaging 0.50
R1847:Rcor3 UTSW 1 192100833 missense possibly damaging 0.83
R1850:Rcor3 UTSW 1 192120111 missense probably benign
R3938:Rcor3 UTSW 1 192101085 missense possibly damaging 0.92
R4403:Rcor3 UTSW 1 192119912 splice site probably null
R4590:Rcor3 UTSW 1 192125917 missense probably damaging 1.00
R4750:Rcor3 UTSW 1 192130449 missense probably damaging 1.00
R5219:Rcor3 UTSW 1 192137513 utr 5 prime probably benign
R5617:Rcor3 UTSW 1 192120130 missense probably benign 0.09
R6059:Rcor3 UTSW 1 192119940 missense probably benign 0.21
R6156:Rcor3 UTSW 1 192127842 unclassified probably benign
R6250:Rcor3 UTSW 1 192100896 missense probably damaging 1.00
R6258:Rcor3 UTSW 1 192124259 missense probably benign 0.27
R6260:Rcor3 UTSW 1 192124259 missense probably benign 0.27
R6808:Rcor3 UTSW 1 192137882 missense possibly damaging 0.79
R7194:Rcor3 UTSW 1 192125961 missense possibly damaging 0.88
R7387:Rcor3 UTSW 1 192137524 start gained probably benign
R7407:Rcor3 UTSW 1 192101672 missense probably benign
R7432:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7451:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7452:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7570:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7571:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7572:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7718:Rcor3 UTSW 1 192101721 missense probably benign 0.00
R7729:Rcor3 UTSW 1 192101778 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGGGTGAGATACTTAGCTTTAAG -3'
(R):5'- ACAGCTCATGGATCATATTGGCT -3'

Sequencing Primer
(F):5'- CTTTAGATGCCCCAGTACAGG -3'
(R):5'- GAAAGAAGCCTAGACCTGA -3'
Posted On2019-09-13