Mutagenetix > Incidental Mutation

Incidental Mutation 'R7402:Cacna1b'

574232

Institutional Source

Beutler Lab

Gene Symbol

Cacna1b

Ensembl Gene

ENSMUSG00000004113

Gene Name

calcium channel, voltage-dependent, N type, alpha 1B subunit

Synonyms

alpha(1B), Cav2.2, Cchn1a

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7402 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24603887-24763152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 24607659 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 2079 (L2079Q)

Ref Sequence

ENSEMBL: ENSMUSP00000037416 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041342] [ENSMUST00000070864] [ENSMUST00000100348] [ENSMUST00000102939] [ENSMUST00000114447] [ENSMUST00000131861] [ENSMUST00000133892]

AlphaFold

O55017

Predicted Effect

probably benign
Transcript: ENSMUST00000041342
AA Change: L2079Q

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000037416
Gene: ENSMUSG00000004113
AA Change: L2079Q

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	133	355	1.2e-57	PFAM
PDB:4DEX\|B	358	467	8e-66	PDB
Pfam:Ion_trans	516	708	1.1e-47	PFAM
Pfam:PKD_channel	569	715	2.3e-7	PFAM
low complexity region	728	739	N/A	INTRINSIC
low complexity region	849	858	N/A	INTRINSIC
low complexity region	903	913	N/A	INTRINSIC
low complexity region	916	933	N/A	INTRINSIC
low complexity region	1091	1102	N/A	INTRINSIC
Pfam:Ion_trans	1174	1408	2.7e-52	PFAM
Pfam:Ion_trans	1498	1698	1.2e-59	PFAM
Pfam:PKD_channel	1551	1705	8.1e-9	PFAM
Ca_chan_IQ	1837	1871	1.09e-11	SMART
low complexity region	2040	2050	N/A	INTRINSIC
low complexity region	2092	2114	N/A	INTRINSIC
low complexity region	2276	2292	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000070864
AA Change: L2040Q

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000063236
Gene: ENSMUSG00000004113
AA Change: L2040Q

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	133	355	1.4e-57	PFAM
PDB:4DEX\|B	358	467	8e-66	PDB
Pfam:Ion_trans	516	708	1.2e-47	PFAM
Pfam:PKD_channel	569	715	1.5e-7	PFAM
low complexity region	728	739	N/A	INTRINSIC
low complexity region	848	857	N/A	INTRINSIC
low complexity region	902	912	N/A	INTRINSIC
low complexity region	915	932	N/A	INTRINSIC
low complexity region	1090	1101	N/A	INTRINSIC
Pfam:Ion_trans	1173	1403	1.8e-52	PFAM
Pfam:Ion_trans	1493	1695	5.4e-60	PFAM
Pfam:PKD_channel	1544	1702	4.9e-9	PFAM
Ca_chan_IQ	1798	1832	7.2e-12	SMART
low complexity region	2001	2011	N/A	INTRINSIC
low complexity region	2053	2075	N/A	INTRINSIC
low complexity region	2237	2253	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100348
AA Change: L2080Q

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000097920
Gene: ENSMUSG00000004113
AA Change: L2080Q

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	133	355	1.4e-57	PFAM
PDB:4DEX\|B	358	468	5e-68	PDB
Pfam:Ion_trans	517	709	1.2e-47	PFAM
Pfam:PKD_channel	570	716	1.6e-7	PFAM
low complexity region	729	740	N/A	INTRINSIC
low complexity region	850	859	N/A	INTRINSIC
low complexity region	904	914	N/A	INTRINSIC
low complexity region	917	934	N/A	INTRINSIC
low complexity region	1092	1103	N/A	INTRINSIC
Pfam:Ion_trans	1175	1409	3.2e-52	PFAM
Pfam:Ion_trans	1499	1699	1.4e-59	PFAM
Pfam:PKD_channel	1552	1706	5.6e-9	PFAM
Ca_chan_IQ	1838	1872	1.09e-11	SMART
low complexity region	2041	2051	N/A	INTRINSIC
low complexity region	2093	2115	N/A	INTRINSIC
low complexity region	2277	2293	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102939
AA Change: L2077Q

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000100003
Gene: ENSMUSG00000004113
AA Change: L2077Q

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	133	355	1.4e-57	PFAM
PDB:4DEX\|B	358	467	1e-65	PDB
Pfam:Ion_trans	516	708	1.2e-47	PFAM
Pfam:PKD_channel	569	715	1.6e-7	PFAM
low complexity region	728	739	N/A	INTRINSIC
low complexity region	849	858	N/A	INTRINSIC
low complexity region	903	913	N/A	INTRINSIC
low complexity region	916	933	N/A	INTRINSIC
low complexity region	1091	1102	N/A	INTRINSIC
Pfam:Ion_trans	1174	1404	1.9e-52	PFAM
Pfam:Ion_trans	1494	1696	5.5e-60	PFAM
Pfam:PKD_channel	1545	1703	5e-9	PFAM
Ca_chan_IQ	1835	1869	1.09e-11	SMART
low complexity region	2038	2048	N/A	INTRINSIC
low complexity region	2090	2112	N/A	INTRINSIC
low complexity region	2274	2290	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114447
AA Change: L2080Q

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000110090
Gene: ENSMUSG00000004113
AA Change: L2080Q

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	94	367	8.5e-69	PFAM
Pfam:Ion_trans	482	721	2.4e-57	PFAM
Pfam:PKD_channel	571	715	1e-7	PFAM
low complexity region	729	740	N/A	INTRINSIC
low complexity region	850	859	N/A	INTRINSIC
low complexity region	904	914	N/A	INTRINSIC
low complexity region	917	934	N/A	INTRINSIC
low complexity region	1092	1103	N/A	INTRINSIC
Pfam:Ion_trans	1139	1421	1.3e-62	PFAM
Pfam:Ion_trans	1464	1711	3.2e-64	PFAM
Pfam:PKD_channel	1550	1706	2.7e-9	PFAM
Pfam:GPHH	1713	1783	1.9e-39	PFAM
Ca_chan_IQ	1838	1872	1.09e-11	SMART
low complexity region	2041	2051	N/A	INTRINSIC
low complexity region	2093	2115	N/A	INTRINSIC
low complexity region	2277	2293	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000125798

Predicted Effect

probably benign
Transcript: ENSMUST00000131861

SMART Domains

Protein: ENSMUSP00000141653
Gene: ENSMUSG00000004113

Domain	Start	End	E-Value	Type
low complexity region	62	77	N/A	INTRINSIC
low complexity region	96	110	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000133892

SMART Domains

Protein: ENSMUSP00000115285
Gene: ENSMUSG00000004113

Domain	Start	End	E-Value	Type
Ca_chan_IQ	23	57	1.09e-11	SMART
low complexity region	215	225	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the pore-forming subunit of an N-type voltage-dependent calcium channel, which controls neurotransmitter release from neurons. The encoded protein forms a complex with alpha-2, beta, and delta subunits to form the high-voltage activated channel. This channel is sensitive to omega-conotoxin-GVIA and omega-agatoxin-IIIA but insensitive to dihydropyridines. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice deficient in this gene exhibit defects in nociception, memory and learning. They also exhibit hyperactive and hyperaggressive behaviors as well as defects in the the sleep-wake cycle. Deficits in the sympathetic nervous system results in defects in circulatory regulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc4	G	T	14: 118,706,075	P12Q	probably damaging	Het
Acsf3	A	G	8: 122,780,424	Y152C	probably damaging	Het
Adam22	T	A	5: 8,095,049	Q803L	possibly damaging	Het
Adamtsl3	G	A	7: 82,578,617	V1337I	probably damaging	Het
Adra1b	T	C	11: 43,776,018	D464G	possibly damaging	Het
Alpk3	T	A	7: 81,076,912	I115K	probably benign	Het
Amdhd2	A	G	17: 24,161,683	S96P		Het
Ankib1	T	G	5: 3,769,586	D111A	probably benign	Het
Arhgef2	A	G	3: 88,633,566	D216G	probably damaging	Het
Astn1	A	T	1: 158,552,855		probably benign	Het
Atrn	T	A	2: 130,947,600	W328R	probably damaging	Het
Atxn7	A	T	14: 14,095,427	H375L	probably damaging	Het
BC003331	A	G	1: 150,386,356		probably null	Het
Btaf1	A	T	19: 37,003,515	N1579Y	probably damaging	Het
Ccdc102a	T	C	8: 94,903,353	K520R	probably damaging	Het
Cd2ap	T	C	17: 42,805,163	H602R	possibly damaging	Het
Cdkn2aip	A	G	8: 47,711,373	V435A	possibly damaging	Het
Cenpf	A	T	1: 189,659,378	Y735*	probably null	Het
Cep350	T	A	1: 155,928,215	I1041L	probably benign	Het
Ckap4	A	G	10: 84,527,999	V400A	probably damaging	Het
Comp	T	A	8: 70,377,204	D359E	probably benign	Het
Coq10b	A	C	1: 55,061,341	K61N	probably benign	Het
Csmd2	A	C	4: 128,322,095	S548R		Het
Csmd2	G	A	4: 128,322,096	S548N		Het
Ctif	A	G	18: 75,611,736	I99T	probably benign	Het
Ctns	T	G	11: 73,193,077	T40P	possibly damaging	Het
Cyp11b1	C	T	15: 74,840,825	R129H	probably damaging	Het
Cyp2c68	A	T	19: 39,740,874	N56K	probably benign	Het
D6Wsu163e	A	G	6: 126,962,005	K401R	probably damaging	Het
Dstn	T	A	2: 143,938,448	C23S	probably benign	Het
Fam214a	C	A	9: 75,006,386	Y107*	probably null	Het
Fam72a	A	T	1: 131,538,875	E132D	probably damaging	Het
Fam72a	G	T	1: 131,538,876	E133*	probably null	Het
Gbp8	T	A	5: 105,031,295	I113F	probably damaging	Het
Gm3095	A	T	14: 3,964,463	R60S	possibly damaging	Het
Gpa33	A	T	1: 166,152,694	M109L	probably damaging	Het
Grik2	A	G	10: 49,535,397	L215P	probably damaging	Het
Gucy2g	A	C	19: 55,206,293	F897L	probably damaging	Het
Hinfp	A	G	9: 44,298,017	L295P	probably damaging	Het
Ift122	T	C	6: 115,894,322	V526A	probably benign	Het
Ighv5-12	T	C	12: 113,702,233	T82A	probably benign	Het
Il18rap	T	A	1: 40,524,951	S76R	probably benign	Het
Itga6	A	T	2: 71,853,553	N1045I	probably benign	Het
Kctd21	A	T	7: 97,347,763	I148F	possibly damaging	Het
Kif28	T	A	1: 179,740,079	H42L	probably benign	Het
Kmt2c	A	C	5: 25,395,420	C326W	probably damaging	Het
Knl1	T	A	2: 119,095,226	L1912*	probably null	Het
Lrfn1	A	T	7: 28,459,522	I289F	probably damaging	Het
Lrriq1	T	C	10: 103,221,324	K205R	possibly damaging	Het
Mbd5	A	T	2: 49,257,554	N592I	probably damaging	Het
Mbl2	A	G	19: 30,239,402	N205D	possibly damaging	Het
Mcm4	C	A	16: 15,637,178	M1I	probably null	Het
Mgat4a	T	A	1: 37,454,784	H327L	probably damaging	Het
Miox	A	G	15: 89,335,003	D16G	probably benign	Het
Mvk	C	A	5: 114,455,978	P298Q	possibly damaging	Het
Nol6	A	G	4: 41,118,699	L726P	probably damaging	Het
Nos1	T	C	5: 117,949,815	I1381T	probably benign	Het
Nup98	A	T	7: 102,134,937	S1063T	probably benign	Het
Obscn	T	G	11: 58,995,449	M7862L	unknown	Het
Obsl1	T	C	1: 75,487,704	T1653A	probably benign	Het
Olfr1044	A	G	2: 86,171,202	I205T	probably benign	Het
Olfr1202	G	T	2: 88,817,343	M57I	probably damaging	Het
Olfr1497	C	T	19: 13,794,994	V206I	probably damaging	Het
Olfr968	T	A	9: 39,771,964	T279S	probably benign	Het
Pcdhb20	A	G	18: 37,504,952	Y177C	probably benign	Het
Pcdhb3	A	C	18: 37,301,604	I208L	probably benign	Het
Phlpp1	G	T	1: 106,389,690	G1214W	probably damaging	Het
Ppp4r3a	A	T	12: 101,058,794	S149T	possibly damaging	Het
Pxdn	T	C	12: 30,002,439	C872R	probably damaging	Het
Rarb	A	G	14: 16,548,419	C101R	probably damaging	Het
Rcor3	A	C	1: 192,127,983	V114G	probably benign	Het
Rnpepl1	A	G	1: 92,919,650	Q653R	probably benign	Het
Rpap2	T	A	5: 107,620,458	Y387*	probably null	Het
Rttn	C	T	18: 88,985,911	T343M	possibly damaging	Het
Samd11	T	C	4: 156,248,773	T333A	probably benign	Het
Six5	T	C	7: 19,095,043	L136P	probably damaging	Het
Slc12a5	T	A	2: 164,982,932	M419K	probably benign	Het
Slc22a21	T	C	11: 53,960,400	M179V	probably benign	Het
Slc35a4	A	G	18: 36,680,517	D6G	unknown	Het
Spdye4c	A	T	2: 128,592,341	M1L	probably benign	Het
Svep1	A	T	4: 58,069,699	C2696S	possibly damaging	Het
Tceanc2	T	C	4: 107,147,696	N85S	probably benign	Het
Teddm2	A	T	1: 153,850,597	L124Q	probably damaging	Het
Teddm2	G	C	1: 153,850,598	L124V	probably benign	Het
Tgfbr1	T	A	4: 47,405,623	W409R	probably damaging	Het
Tkt	A	G	14: 30,558,798	D62G	probably damaging	Het
Tnrc6b	T	A	15: 80,884,300	V1054D	probably damaging	Het
Trpm7	C	A	2: 126,799,206	L1564F	probably damaging	Het
Vmn1r43	A	T	6: 89,869,821	C228S	probably benign	Het
Vmn2r106	T	C	17: 20,267,621	R839G	probably damaging	Het
Vmn2r5	G	A	3: 64,495,755	T523I	probably benign	Het
Vwa3b	C	T	1: 37,114,597	Q507*	probably null	Het
Wrn	C	G	8: 33,248,966	W1278S	probably benign	Het
Zfp281	T	G	1: 136,625,452	L56R	probably damaging	Het
Zfp407	G	A	18: 84,561,536	T484I	probably benign	Het
Zfp451	T	C	1: 33,813,762	T24A	probably benign	Het
Zfp607b	T	A	7: 27,693,494	F16I	probably damaging	Het
Zfp638	T	A	6: 83,928,688	V41E	possibly damaging	Het

Other mutations in Cacna1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Cacna1b	APN	2	24651200	nonsense	probably null
IGL00508:Cacna1b	APN	2	24657289	critical splice donor site	probably null
IGL01085:Cacna1b	APN	2	24678994	missense	probably damaging	0.98
IGL01310:Cacna1b	APN	2	24685782	missense	probably damaging	1.00
IGL01361:Cacna1b	APN	2	24679095	missense	possibly damaging	0.49
IGL01471:Cacna1b	APN	2	24657292	missense	probably damaging	1.00
IGL01537:Cacna1b	APN	2	24658528	missense	probably damaging	1.00
IGL01547:Cacna1b	APN	2	24632035	unclassified	probably benign
IGL01750:Cacna1b	APN	2	24654395	missense	probably damaging	1.00
IGL01813:Cacna1b	APN	2	24609890	missense	probably damaging	1.00
IGL01939:Cacna1b	APN	2	24661757	missense	probably damaging	1.00
IGL01955:Cacna1b	APN	2	24639137	missense	probably damaging	1.00
IGL01972:Cacna1b	APN	2	24635095	critical splice donor site	probably null
IGL01987:Cacna1b	APN	2	24697567	splice site	probably null
IGL02096:Cacna1b	APN	2	24678915	missense	probably benign	0.01
IGL02111:Cacna1b	APN	2	24606991	missense	probably damaging	0.96
IGL02254:Cacna1b	APN	2	24616815	splice site	probably null
IGL03084:Cacna1b	APN	2	24609932	missense	probably benign
IGL03184:Cacna1b	APN	2	24658489	critical splice donor site	probably null
IGL03202:Cacna1b	APN	2	24651112	missense	probably damaging	1.00
IGL03210:Cacna1b	APN	2	24650572	missense	probably benign	0.00
IGL03402:Cacna1b	APN	2	24762809	missense	probably damaging	1.00
PIT4283001:Cacna1b	UTSW	2	24631941	missense	probably damaging	1.00
R0062:Cacna1b	UTSW	2	24758331	missense	probably damaging	1.00
R0062:Cacna1b	UTSW	2	24758331	missense	probably damaging	1.00
R0206:Cacna1b	UTSW	2	24607480	missense	probably damaging	1.00
R0208:Cacna1b	UTSW	2	24607480	missense	probably damaging	1.00
R0240:Cacna1b	UTSW	2	24638657	unclassified	probably benign
R0265:Cacna1b	UTSW	2	24761844	missense	probably damaging	1.00
R0352:Cacna1b	UTSW	2	24625232	intron	probably benign
R0376:Cacna1b	UTSW	2	24659003	splice site	probably benign
R0383:Cacna1b	UTSW	2	24761844	missense	probably damaging	1.00
R0432:Cacna1b	UTSW	2	24687704	missense	probably damaging	1.00
R0595:Cacna1b	UTSW	2	24649989	splice site	probably benign
R0660:Cacna1b	UTSW	2	24654446	missense	probably damaging	1.00
R0664:Cacna1b	UTSW	2	24654446	missense	probably damaging	1.00
R1107:Cacna1b	UTSW	2	24697603	missense	probably damaging	1.00
R1184:Cacna1b	UTSW	2	24687745	splice site	probably null
R1445:Cacna1b	UTSW	2	24718136	splice site	probably benign
R1446:Cacna1b	UTSW	2	24706177	missense	probably benign	0.01
R1496:Cacna1b	UTSW	2	24678035	missense	probably benign
R1614:Cacna1b	UTSW	2	24690807	missense	possibly damaging	0.88
R1626:Cacna1b	UTSW	2	24606709	missense	probably damaging	1.00
R1917:Cacna1b	UTSW	2	24616879	missense	probably null	0.80
R1984:Cacna1b	UTSW	2	24648986	missense	probably damaging	1.00
R1986:Cacna1b	UTSW	2	24648986	missense	probably damaging	1.00
R1989:Cacna1b	UTSW	2	24721374	missense	probably damaging	1.00
R1990:Cacna1b	UTSW	2	24732306	missense	probably damaging	1.00
R1991:Cacna1b	UTSW	2	24732306	missense	probably damaging	1.00
R1992:Cacna1b	UTSW	2	24732306	missense	probably damaging	1.00
R2098:Cacna1b	UTSW	2	24650546	missense	probably damaging	1.00
R2139:Cacna1b	UTSW	2	24679473	missense	probably benign	0.07
R2196:Cacna1b	UTSW	2	24761788	missense	probably damaging	1.00
R2229:Cacna1b	UTSW	2	24685804	missense	probably damaging	1.00
R2292:Cacna1b	UTSW	2	24606620	missense	probably benign	0.01
R2570:Cacna1b	UTSW	2	24606637	nonsense	probably null
R2850:Cacna1b	UTSW	2	24761788	missense	probably damaging	1.00
R2911:Cacna1b	UTSW	2	24607541	splice site	probably null
R2937:Cacna1b	UTSW	2	24606528	missense	probably benign	0.00
R2938:Cacna1b	UTSW	2	24606528	missense	probably benign	0.00
R3522:Cacna1b	UTSW	2	24763043	missense	possibly damaging	0.94
R3800:Cacna1b	UTSW	2	24658959	missense	probably benign	0.15
R4166:Cacna1b	UTSW	2	24677911	missense	probably benign	0.32
R4300:Cacna1b	UTSW	2	24635239	missense	probably damaging	1.00
R4366:Cacna1b	UTSW	2	24702620	missense	probably damaging	1.00
R4493:Cacna1b	UTSW	2	24652938	missense	probably damaging	0.99
R4494:Cacna1b	UTSW	2	24652938	missense	probably damaging	0.99
R4522:Cacna1b	UTSW	2	24654430	missense	probably damaging	1.00
R4612:Cacna1b	UTSW	2	24626852	nonsense	probably null
R4673:Cacna1b	UTSW	2	24631944	missense	probably damaging	1.00
R4703:Cacna1b	UTSW	2	24654463	missense	probably damaging	1.00
R4704:Cacna1b	UTSW	2	24654463	missense	probably damaging	1.00
R4777:Cacna1b	UTSW	2	24732325	missense	probably damaging	1.00
R4795:Cacna1b	UTSW	2	24637487	missense	possibly damaging	0.58
R4796:Cacna1b	UTSW	2	24637487	missense	possibly damaging	0.58
R4962:Cacna1b	UTSW	2	24618318	missense	probably damaging	1.00
R4962:Cacna1b	UTSW	2	24657366	missense	probably damaging	1.00
R4974:Cacna1b	UTSW	2	24648523	missense	probably damaging	0.99
R4990:Cacna1b	UTSW	2	24678874	critical splice donor site	probably null
R5109:Cacna1b	UTSW	2	24690785	missense	possibly damaging	0.88
R5117:Cacna1b	UTSW	2	24732328	missense	probably damaging	1.00
R5176:Cacna1b	UTSW	2	24635131	missense	probably damaging	1.00
R5253:Cacna1b	UTSW	2	24719952	missense	probably damaging	1.00
R5372:Cacna1b	UTSW	2	24733959	missense	probably damaging	1.00
R5374:Cacna1b	UTSW	2	24706216	missense	probably damaging	1.00
R5465:Cacna1b	UTSW	2	24650426	critical splice donor site	probably null
R5568:Cacna1b	UTSW	2	24607600	missense	probably damaging	1.00
R5580:Cacna1b	UTSW	2	24650554	missense	probably damaging	1.00
R5677:Cacna1b	UTSW	2	24679358	missense	possibly damaging	0.64
R6277:Cacna1b	UTSW	2	24730796	missense	probably damaging	1.00
R6294:Cacna1b	UTSW	2	24719057	missense	possibly damaging	0.94
R6609:Cacna1b	UTSW	2	24653049	missense	probably damaging	1.00
R6929:Cacna1b	UTSW	2	24632010	missense	probably damaging	1.00
R7016:Cacna1b	UTSW	2	24762848	missense	possibly damaging	0.77
R7112:Cacna1b	UTSW	2	24690761	missense	probably damaging	0.97
R7162:Cacna1b	UTSW	2	24700022	missense	probably benign	0.06
R7401:Cacna1b	UTSW	2	24679294	missense	probably benign	0.00
R7442:Cacna1b	UTSW	2	24607501	missense	probably benign
R7450:Cacna1b	UTSW	2	24635135	nonsense	probably null
R7481:Cacna1b	UTSW	2	24616862	missense	probably damaging	0.99
R7792:Cacna1b	UTSW	2	24677965	missense	probably damaging	0.99
R7999:Cacna1b	UTSW	2	24650626	missense	probably damaging	1.00
R8041:Cacna1b	UTSW	2	24657299	missense	probably damaging	1.00
R8084:Cacna1b	UTSW	2	24685796	missense	probably benign	0.21
R8147:Cacna1b	UTSW	2	24679176	missense	probably damaging	0.97
R8170:Cacna1b	UTSW	2	24678874	critical splice donor site	probably null
R8371:Cacna1b	UTSW	2	24720024	missense	possibly damaging	0.46
R8391:Cacna1b	UTSW	2	24706200	missense	probably damaging	1.00
R8723:Cacna1b	UTSW	2	24658498	missense	probably damaging	1.00
R8836:Cacna1b	UTSW	2	24652970	missense	possibly damaging	0.93
R8856:Cacna1b	UTSW	2	24679518	missense	probably benign	0.00
R8922:Cacna1b	UTSW	2	24732328	missense	possibly damaging	0.94
R8940:Cacna1b	UTSW	2	24763072	unclassified	probably benign
R9140:Cacna1b	UTSW	2	24635212	missense	probably damaging	1.00
R9414:Cacna1b	UTSW	2	24648502	missense	probably damaging	0.99
R9476:Cacna1b	UTSW	2	24650046	missense	probably damaging	0.99
R9510:Cacna1b	UTSW	2	24650046	missense	probably damaging	0.99
R9520:Cacna1b	UTSW	2	24761787	missense	probably damaging	0.97
R9566:Cacna1b	UTSW	2	24608080	nonsense	probably null
R9671:Cacna1b	UTSW	2	24706270	missense	probably benign	0.00
R9757:Cacna1b	UTSW	2	24719101	missense	probably damaging	0.99
R9784:Cacna1b	UTSW	2	24761789	missense	possibly damaging	0.88
R9797:Cacna1b	UTSW	2	24618275	missense	probably damaging	1.00
Z1088:Cacna1b	UTSW	2	24661844	missense	probably damaging	1.00
Z1088:Cacna1b	UTSW	2	24733945	missense	probably damaging	1.00
Z1176:Cacna1b	UTSW	2	24626884	nonsense	probably null
Z1177:Cacna1b	UTSW	2	24638677	missense	probably damaging	0.98
Z1177:Cacna1b	UTSW	2	24661790	missense	probably damaging	1.00
Z1177:Cacna1b	UTSW	2	24678988	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CTACTGAGTGAGGGCATCAG -3'
(R):5'- AATGCTTATGGCCTGACTGG -3'

Sequencing Primer
(F):5'- ATCAGTTGCGGGGGCTC -3'
(R):5'- ATATGGTCCCAGAATCTGCCATTGG -3'

Posted On

2019-09-13