Incidental Mutation 'R7402:Cacna1b'
ID574232
Institutional Source Beutler Lab
Gene Symbol Cacna1b
Ensembl Gene ENSMUSG00000004113
Gene Namecalcium channel, voltage-dependent, N type, alpha 1B subunit
Synonymsalpha(1B), Cav2.2, Cchn1a
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7402 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location24603887-24763152 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24607659 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 2079 (L2079Q)
Ref Sequence ENSEMBL: ENSMUSP00000037416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041342] [ENSMUST00000070864] [ENSMUST00000100348] [ENSMUST00000102939] [ENSMUST00000114447] [ENSMUST00000131861] [ENSMUST00000133892]
Predicted Effect probably benign
Transcript: ENSMUST00000041342
AA Change: L2079Q

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000037416
Gene: ENSMUSG00000004113
AA Change: L2079Q

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 133 355 1.2e-57 PFAM
PDB:4DEX|B 358 467 8e-66 PDB
Pfam:Ion_trans 516 708 1.1e-47 PFAM
Pfam:PKD_channel 569 715 2.3e-7 PFAM
low complexity region 728 739 N/A INTRINSIC
low complexity region 849 858 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
low complexity region 916 933 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Pfam:Ion_trans 1174 1408 2.7e-52 PFAM
Pfam:Ion_trans 1498 1698 1.2e-59 PFAM
Pfam:PKD_channel 1551 1705 8.1e-9 PFAM
Ca_chan_IQ 1837 1871 1.09e-11 SMART
low complexity region 2040 2050 N/A INTRINSIC
low complexity region 2092 2114 N/A INTRINSIC
low complexity region 2276 2292 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070864
AA Change: L2040Q

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000063236
Gene: ENSMUSG00000004113
AA Change: L2040Q

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 133 355 1.4e-57 PFAM
PDB:4DEX|B 358 467 8e-66 PDB
Pfam:Ion_trans 516 708 1.2e-47 PFAM
Pfam:PKD_channel 569 715 1.5e-7 PFAM
low complexity region 728 739 N/A INTRINSIC
low complexity region 848 857 N/A INTRINSIC
low complexity region 902 912 N/A INTRINSIC
low complexity region 915 932 N/A INTRINSIC
low complexity region 1090 1101 N/A INTRINSIC
Pfam:Ion_trans 1173 1403 1.8e-52 PFAM
Pfam:Ion_trans 1493 1695 5.4e-60 PFAM
Pfam:PKD_channel 1544 1702 4.9e-9 PFAM
Ca_chan_IQ 1798 1832 7.2e-12 SMART
low complexity region 2001 2011 N/A INTRINSIC
low complexity region 2053 2075 N/A INTRINSIC
low complexity region 2237 2253 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100348
AA Change: L2080Q

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097920
Gene: ENSMUSG00000004113
AA Change: L2080Q

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 133 355 1.4e-57 PFAM
PDB:4DEX|B 358 468 5e-68 PDB
Pfam:Ion_trans 517 709 1.2e-47 PFAM
Pfam:PKD_channel 570 716 1.6e-7 PFAM
low complexity region 729 740 N/A INTRINSIC
low complexity region 850 859 N/A INTRINSIC
low complexity region 904 914 N/A INTRINSIC
low complexity region 917 934 N/A INTRINSIC
low complexity region 1092 1103 N/A INTRINSIC
Pfam:Ion_trans 1175 1409 3.2e-52 PFAM
Pfam:Ion_trans 1499 1699 1.4e-59 PFAM
Pfam:PKD_channel 1552 1706 5.6e-9 PFAM
Ca_chan_IQ 1838 1872 1.09e-11 SMART
low complexity region 2041 2051 N/A INTRINSIC
low complexity region 2093 2115 N/A INTRINSIC
low complexity region 2277 2293 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102939
AA Change: L2077Q

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000100003
Gene: ENSMUSG00000004113
AA Change: L2077Q

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 133 355 1.4e-57 PFAM
PDB:4DEX|B 358 467 1e-65 PDB
Pfam:Ion_trans 516 708 1.2e-47 PFAM
Pfam:PKD_channel 569 715 1.6e-7 PFAM
low complexity region 728 739 N/A INTRINSIC
low complexity region 849 858 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
low complexity region 916 933 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Pfam:Ion_trans 1174 1404 1.9e-52 PFAM
Pfam:Ion_trans 1494 1696 5.5e-60 PFAM
Pfam:PKD_channel 1545 1703 5e-9 PFAM
Ca_chan_IQ 1835 1869 1.09e-11 SMART
low complexity region 2038 2048 N/A INTRINSIC
low complexity region 2090 2112 N/A INTRINSIC
low complexity region 2274 2290 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114447
AA Change: L2080Q

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110090
Gene: ENSMUSG00000004113
AA Change: L2080Q

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 94 367 8.5e-69 PFAM
Pfam:Ion_trans 482 721 2.4e-57 PFAM
Pfam:PKD_channel 571 715 1e-7 PFAM
low complexity region 729 740 N/A INTRINSIC
low complexity region 850 859 N/A INTRINSIC
low complexity region 904 914 N/A INTRINSIC
low complexity region 917 934 N/A INTRINSIC
low complexity region 1092 1103 N/A INTRINSIC
Pfam:Ion_trans 1139 1421 1.3e-62 PFAM
Pfam:Ion_trans 1464 1711 3.2e-64 PFAM
Pfam:PKD_channel 1550 1706 2.7e-9 PFAM
Pfam:GPHH 1713 1783 1.9e-39 PFAM
Ca_chan_IQ 1838 1872 1.09e-11 SMART
low complexity region 2041 2051 N/A INTRINSIC
low complexity region 2093 2115 N/A INTRINSIC
low complexity region 2277 2293 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125798
Predicted Effect probably benign
Transcript: ENSMUST00000131861
SMART Domains Protein: ENSMUSP00000141653
Gene: ENSMUSG00000004113

DomainStartEndE-ValueType
low complexity region 62 77 N/A INTRINSIC
low complexity region 96 110 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133892
SMART Domains Protein: ENSMUSP00000115285
Gene: ENSMUSG00000004113

DomainStartEndE-ValueType
Ca_chan_IQ 23 57 1.09e-11 SMART
low complexity region 215 225 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the pore-forming subunit of an N-type voltage-dependent calcium channel, which controls neurotransmitter release from neurons. The encoded protein forms a complex with alpha-2, beta, and delta subunits to form the high-voltage activated channel. This channel is sensitive to omega-conotoxin-GVIA and omega-agatoxin-IIIA but insensitive to dihydropyridines. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice deficient in this gene exhibit defects in nociception, memory and learning. They also exhibit hyperactive and hyperaggressive behaviors as well as defects in the the sleep-wake cycle. Deficits in the sympathetic nervous system results in defects in circulatory regulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 G T 14: 118,706,075 P12Q probably damaging Het
Acsf3 A G 8: 122,780,424 Y152C probably damaging Het
Adam22 T A 5: 8,095,049 Q803L possibly damaging Het
Adamtsl3 G A 7: 82,578,617 V1337I probably damaging Het
Adra1b T C 11: 43,776,018 D464G possibly damaging Het
Alpk3 T A 7: 81,076,912 I115K probably benign Het
Amdhd2 A G 17: 24,161,683 S96P Het
Ankib1 T G 5: 3,769,586 D111A probably benign Het
Arhgef2 A G 3: 88,633,566 D216G probably damaging Het
Astn1 A T 1: 158,552,855 probably benign Het
Atrn T A 2: 130,947,600 W328R probably damaging Het
Atxn7 A T 14: 14,095,427 H375L probably damaging Het
BC003331 A G 1: 150,386,356 probably null Het
Btaf1 A T 19: 37,003,515 N1579Y probably damaging Het
Ccdc102a T C 8: 94,903,353 K520R probably damaging Het
Cd2ap T C 17: 42,805,163 H602R possibly damaging Het
Cdkn2aip A G 8: 47,711,373 V435A possibly damaging Het
Cenpf A T 1: 189,659,378 Y735* probably null Het
Cep350 T A 1: 155,928,215 I1041L probably benign Het
Ckap4 A G 10: 84,527,999 V400A probably damaging Het
Comp T A 8: 70,377,204 D359E probably benign Het
Coq10b A C 1: 55,061,341 K61N probably benign Het
Csmd2 A C 4: 128,322,095 S548R Het
Csmd2 G A 4: 128,322,096 S548N Het
Ctif A G 18: 75,611,736 I99T probably benign Het
Ctns T G 11: 73,193,077 T40P possibly damaging Het
Cyp11b1 C T 15: 74,840,825 R129H probably damaging Het
Cyp2c68 A T 19: 39,740,874 N56K probably benign Het
D6Wsu163e A G 6: 126,962,005 K401R probably damaging Het
Dstn T A 2: 143,938,448 C23S probably benign Het
Fam214a C A 9: 75,006,386 Y107* probably null Het
Fam72a A T 1: 131,538,875 E132D probably damaging Het
Fam72a G T 1: 131,538,876 E133* probably null Het
Gbp8 T A 5: 105,031,295 I113F probably damaging Het
Gm3095 A T 14: 3,964,463 R60S possibly damaging Het
Gpa33 A T 1: 166,152,694 M109L probably damaging Het
Grik2 A G 10: 49,535,397 L215P probably damaging Het
Gucy2g A C 19: 55,206,293 F897L probably damaging Het
Hinfp A G 9: 44,298,017 L295P probably damaging Het
Ift122 T C 6: 115,894,322 V526A probably benign Het
Ighv5-12 T C 12: 113,702,233 T82A probably benign Het
Il18rap T A 1: 40,524,951 S76R probably benign Het
Itga6 A T 2: 71,853,553 N1045I probably benign Het
Kctd21 A T 7: 97,347,763 I148F possibly damaging Het
Kif28 T A 1: 179,740,079 H42L probably benign Het
Kmt2c A C 5: 25,395,420 C326W probably damaging Het
Knl1 T A 2: 119,095,226 L1912* probably null Het
Lrfn1 A T 7: 28,459,522 I289F probably damaging Het
Lrriq1 T C 10: 103,221,324 K205R possibly damaging Het
Mbd5 A T 2: 49,257,554 N592I probably damaging Het
Mbl2 A G 19: 30,239,402 N205D possibly damaging Het
Mcm4 C A 16: 15,637,178 M1I probably null Het
Mgat4a T A 1: 37,454,784 H327L probably damaging Het
Miox A G 15: 89,335,003 D16G probably benign Het
Mvk C A 5: 114,455,978 P298Q possibly damaging Het
Nol6 A G 4: 41,118,699 L726P probably damaging Het
Nos1 T C 5: 117,949,815 I1381T probably benign Het
Nup98 A T 7: 102,134,937 S1063T probably benign Het
Obscn T G 11: 58,995,449 M7862L unknown Het
Obsl1 T C 1: 75,487,704 T1653A probably benign Het
Olfr1044 A G 2: 86,171,202 I205T probably benign Het
Olfr1202 G T 2: 88,817,343 M57I probably damaging Het
Olfr1497 C T 19: 13,794,994 V206I probably damaging Het
Olfr968 T A 9: 39,771,964 T279S probably benign Het
Pcdhb20 A G 18: 37,504,952 Y177C probably benign Het
Pcdhb3 A C 18: 37,301,604 I208L probably benign Het
Phlpp1 G T 1: 106,389,690 G1214W probably damaging Het
Ppp4r3a A T 12: 101,058,794 S149T possibly damaging Het
Pxdn T C 12: 30,002,439 C872R probably damaging Het
Rarb A G 14: 16,548,419 C101R probably damaging Het
Rcor3 A C 1: 192,127,983 V114G probably benign Het
Rnpepl1 A G 1: 92,919,650 Q653R probably benign Het
Rpap2 T A 5: 107,620,458 Y387* probably null Het
Rttn C T 18: 88,985,911 T343M possibly damaging Het
Samd11 T C 4: 156,248,773 T333A probably benign Het
Six5 T C 7: 19,095,043 L136P probably damaging Het
Slc12a5 T A 2: 164,982,932 M419K probably benign Het
Slc22a21 T C 11: 53,960,400 M179V probably benign Het
Slc35a4 A G 18: 36,680,517 D6G unknown Het
Spdye4c A T 2: 128,592,341 M1L probably benign Het
Svep1 A T 4: 58,069,699 C2696S possibly damaging Het
Tceanc2 T C 4: 107,147,696 N85S probably benign Het
Teddm2 A T 1: 153,850,597 L124Q probably damaging Het
Teddm2 G C 1: 153,850,598 L124V probably benign Het
Tgfbr1 T A 4: 47,405,623 W409R probably damaging Het
Tkt A G 14: 30,558,798 D62G probably damaging Het
Tnrc6b T A 15: 80,884,300 V1054D probably damaging Het
Trpm7 C A 2: 126,799,206 L1564F probably damaging Het
Vmn1r43 A T 6: 89,869,821 C228S probably benign Het
Vmn2r106 T C 17: 20,267,621 R839G probably damaging Het
Vmn2r5 G A 3: 64,495,755 T523I probably benign Het
Vwa3b C T 1: 37,114,597 Q507* probably null Het
Wrn C G 8: 33,248,966 W1278S probably benign Het
Zfp281 T G 1: 136,625,452 L56R probably damaging Het
Zfp407 G A 18: 84,561,536 T484I probably benign Het
Zfp451 T C 1: 33,813,762 T24A probably benign Het
Zfp607b T A 7: 27,693,494 F16I probably damaging Het
Zfp638 T A 6: 83,928,688 V41E possibly damaging Het
Other mutations in Cacna1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Cacna1b APN 2 24651200 nonsense probably null
IGL00508:Cacna1b APN 2 24657289 critical splice donor site probably null
IGL01085:Cacna1b APN 2 24678994 missense probably damaging 0.98
IGL01310:Cacna1b APN 2 24685782 missense probably damaging 1.00
IGL01361:Cacna1b APN 2 24679095 missense possibly damaging 0.49
IGL01471:Cacna1b APN 2 24657292 missense probably damaging 1.00
IGL01537:Cacna1b APN 2 24658528 missense probably damaging 1.00
IGL01547:Cacna1b APN 2 24632035 unclassified probably benign
IGL01750:Cacna1b APN 2 24654395 missense probably damaging 1.00
IGL01813:Cacna1b APN 2 24609890 missense probably damaging 1.00
IGL01939:Cacna1b APN 2 24661757 missense probably damaging 1.00
IGL01955:Cacna1b APN 2 24639137 missense probably damaging 1.00
IGL01972:Cacna1b APN 2 24635095 critical splice donor site probably null
IGL01987:Cacna1b APN 2 24697567 splice site probably null
IGL02096:Cacna1b APN 2 24678915 missense probably benign 0.01
IGL02111:Cacna1b APN 2 24606991 missense probably damaging 0.96
IGL02254:Cacna1b APN 2 24616815 splice site probably null
IGL03084:Cacna1b APN 2 24609932 missense probably benign
IGL03184:Cacna1b APN 2 24658489 critical splice donor site probably null
IGL03202:Cacna1b APN 2 24651112 missense probably damaging 1.00
IGL03210:Cacna1b APN 2 24650572 missense probably benign 0.00
IGL03402:Cacna1b APN 2 24762809 missense probably damaging 1.00
PIT4283001:Cacna1b UTSW 2 24631941 missense probably damaging 1.00
R0062:Cacna1b UTSW 2 24758331 missense probably damaging 1.00
R0062:Cacna1b UTSW 2 24758331 missense probably damaging 1.00
R0206:Cacna1b UTSW 2 24607480 missense probably damaging 1.00
R0208:Cacna1b UTSW 2 24607480 missense probably damaging 1.00
R0240:Cacna1b UTSW 2 24638657 unclassified probably benign
R0265:Cacna1b UTSW 2 24761844 missense probably damaging 1.00
R0352:Cacna1b UTSW 2 24625232 intron probably benign
R0376:Cacna1b UTSW 2 24659003 splice site probably benign
R0383:Cacna1b UTSW 2 24761844 missense probably damaging 1.00
R0432:Cacna1b UTSW 2 24687704 missense probably damaging 1.00
R0595:Cacna1b UTSW 2 24649989 splice site probably benign
R0660:Cacna1b UTSW 2 24654446 missense probably damaging 1.00
R0664:Cacna1b UTSW 2 24654446 missense probably damaging 1.00
R1107:Cacna1b UTSW 2 24697603 missense probably damaging 1.00
R1184:Cacna1b UTSW 2 24687745 unclassified probably null
R1445:Cacna1b UTSW 2 24718136 splice site probably benign
R1446:Cacna1b UTSW 2 24706177 missense probably benign 0.01
R1496:Cacna1b UTSW 2 24678035 missense probably benign
R1614:Cacna1b UTSW 2 24690807 missense possibly damaging 0.88
R1626:Cacna1b UTSW 2 24606709 missense probably damaging 1.00
R1917:Cacna1b UTSW 2 24616879 missense probably null 0.80
R1984:Cacna1b UTSW 2 24648986 missense probably damaging 1.00
R1986:Cacna1b UTSW 2 24648986 missense probably damaging 1.00
R1989:Cacna1b UTSW 2 24721374 missense probably damaging 1.00
R1990:Cacna1b UTSW 2 24732306 missense probably damaging 1.00
R1991:Cacna1b UTSW 2 24732306 missense probably damaging 1.00
R1992:Cacna1b UTSW 2 24732306 missense probably damaging 1.00
R2098:Cacna1b UTSW 2 24650546 missense probably damaging 1.00
R2139:Cacna1b UTSW 2 24679473 missense probably benign 0.07
R2196:Cacna1b UTSW 2 24761788 missense probably damaging 1.00
R2229:Cacna1b UTSW 2 24685804 missense probably damaging 1.00
R2292:Cacna1b UTSW 2 24606620 missense probably benign 0.01
R2570:Cacna1b UTSW 2 24606637 nonsense probably null
R2850:Cacna1b UTSW 2 24761788 missense probably damaging 1.00
R2911:Cacna1b UTSW 2 24607541 unclassified probably null
R2937:Cacna1b UTSW 2 24606528 missense probably benign 0.00
R2938:Cacna1b UTSW 2 24606528 missense probably benign 0.00
R3522:Cacna1b UTSW 2 24763043 missense possibly damaging 0.94
R3800:Cacna1b UTSW 2 24658959 missense probably benign 0.15
R4166:Cacna1b UTSW 2 24677911 missense probably benign 0.32
R4300:Cacna1b UTSW 2 24635239 missense probably damaging 1.00
R4366:Cacna1b UTSW 2 24702620 missense probably damaging 1.00
R4493:Cacna1b UTSW 2 24652938 missense probably damaging 0.99
R4494:Cacna1b UTSW 2 24652938 missense probably damaging 0.99
R4522:Cacna1b UTSW 2 24654430 missense probably damaging 1.00
R4612:Cacna1b UTSW 2 24626852 nonsense probably null
R4673:Cacna1b UTSW 2 24631944 missense probably damaging 1.00
R4703:Cacna1b UTSW 2 24654463 missense probably damaging 1.00
R4704:Cacna1b UTSW 2 24654463 missense probably damaging 1.00
R4777:Cacna1b UTSW 2 24732325 missense probably damaging 1.00
R4795:Cacna1b UTSW 2 24637487 missense possibly damaging 0.58
R4796:Cacna1b UTSW 2 24637487 missense possibly damaging 0.58
R4962:Cacna1b UTSW 2 24618318 missense probably damaging 1.00
R4962:Cacna1b UTSW 2 24657366 missense probably damaging 1.00
R4974:Cacna1b UTSW 2 24648523 missense probably damaging 0.99
R4990:Cacna1b UTSW 2 24678874 critical splice donor site probably null
R5109:Cacna1b UTSW 2 24690785 missense possibly damaging 0.88
R5117:Cacna1b UTSW 2 24732328 missense probably damaging 1.00
R5176:Cacna1b UTSW 2 24635131 missense probably damaging 1.00
R5253:Cacna1b UTSW 2 24719952 missense probably damaging 1.00
R5372:Cacna1b UTSW 2 24733959 missense probably damaging 1.00
R5374:Cacna1b UTSW 2 24706216 missense probably damaging 1.00
R5465:Cacna1b UTSW 2 24650426 critical splice donor site probably null
R5568:Cacna1b UTSW 2 24607600 missense probably damaging 1.00
R5580:Cacna1b UTSW 2 24650554 missense probably damaging 1.00
R5677:Cacna1b UTSW 2 24679358 missense possibly damaging 0.64
R6277:Cacna1b UTSW 2 24730796 missense probably damaging 1.00
R6294:Cacna1b UTSW 2 24719057 missense possibly damaging 0.94
R6609:Cacna1b UTSW 2 24653049 missense probably damaging 1.00
R6929:Cacna1b UTSW 2 24632010 missense probably damaging 1.00
R7016:Cacna1b UTSW 2 24762848 missense possibly damaging 0.77
R7112:Cacna1b UTSW 2 24690761 missense probably damaging 0.97
R7162:Cacna1b UTSW 2 24700022 missense probably benign 0.06
R7401:Cacna1b UTSW 2 24679294 missense probably benign 0.00
R7442:Cacna1b UTSW 2 24607501 missense probably benign
R7450:Cacna1b UTSW 2 24635135 nonsense probably null
R7481:Cacna1b UTSW 2 24616862 missense probably damaging 0.99
Z1088:Cacna1b UTSW 2 24661844 missense probably damaging 1.00
Z1088:Cacna1b UTSW 2 24733945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACTGAGTGAGGGCATCAG -3'
(R):5'- AATGCTTATGGCCTGACTGG -3'

Sequencing Primer
(F):5'- ATCAGTTGCGGGGGCTC -3'
(R):5'- ATATGGTCCCAGAATCTGCCATTGG -3'
Posted On2019-09-13