Incidental Mutation 'R7402:Vmn2r5'
ID574243
Institutional Source Beutler Lab
Gene Symbol Vmn2r5
Ensembl Gene ENSMUSG00000068999
Gene Namevomeronasal 2, receptor 5
SynonymsEG667060
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R7402 (G1)
Quality Score205.009
Status Not validated
Chromosome3
Chromosomal Location64490821-64509735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 64495755 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 523 (T523I)
Ref Sequence ENSEMBL: ENSMUSP00000135592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170270] [ENSMUST00000177184]
Predicted Effect probably benign
Transcript: ENSMUST00000170270
AA Change: T436I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000131925
Gene: ENSMUSG00000068999
AA Change: T436I

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 9.9e-78 PFAM
Pfam:NCD3G 458 511 8.5e-18 PFAM
Pfam:7tm_3 542 779 2.3e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177184
AA Change: T523I

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000135592
Gene: ENSMUSG00000068999
AA Change: T523I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 86 503 1.8e-80 PFAM
Pfam:NCD3G 545 598 1e-14 PFAM
Pfam:7tm_3 631 865 1.4e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 G T 14: 118,706,075 P12Q probably damaging Het
Acsf3 A G 8: 122,780,424 Y152C probably damaging Het
Adam22 T A 5: 8,095,049 Q803L possibly damaging Het
Adamtsl3 G A 7: 82,578,617 V1337I probably damaging Het
Adra1b T C 11: 43,776,018 D464G possibly damaging Het
Alpk3 T A 7: 81,076,912 I115K probably benign Het
Amdhd2 A G 17: 24,161,683 S96P Het
Ankib1 T G 5: 3,769,586 D111A probably benign Het
Arhgef2 A G 3: 88,633,566 D216G probably damaging Het
Astn1 A T 1: 158,552,855 probably benign Het
Atrn T A 2: 130,947,600 W328R probably damaging Het
Atxn7 A T 14: 14,095,427 H375L probably damaging Het
BC003331 A G 1: 150,386,356 probably null Het
Btaf1 A T 19: 37,003,515 N1579Y probably damaging Het
Cacna1b A T 2: 24,607,659 L2079Q probably benign Het
Ccdc102a T C 8: 94,903,353 K520R probably damaging Het
Cd2ap T C 17: 42,805,163 H602R possibly damaging Het
Cdkn2aip A G 8: 47,711,373 V435A possibly damaging Het
Cenpf A T 1: 189,659,378 Y735* probably null Het
Cep350 T A 1: 155,928,215 I1041L probably benign Het
Ckap4 A G 10: 84,527,999 V400A probably damaging Het
Comp T A 8: 70,377,204 D359E probably benign Het
Coq10b A C 1: 55,061,341 K61N probably benign Het
Csmd2 A C 4: 128,322,095 S548R Het
Csmd2 G A 4: 128,322,096 S548N Het
Ctif A G 18: 75,611,736 I99T probably benign Het
Ctns T G 11: 73,193,077 T40P possibly damaging Het
Cyp11b1 C T 15: 74,840,825 R129H probably damaging Het
Cyp2c68 A T 19: 39,740,874 N56K probably benign Het
D6Wsu163e A G 6: 126,962,005 K401R probably damaging Het
Dstn T A 2: 143,938,448 C23S probably benign Het
Fam214a C A 9: 75,006,386 Y107* probably null Het
Fam72a A T 1: 131,538,875 E132D probably damaging Het
Fam72a G T 1: 131,538,876 E133* probably null Het
Gbp8 T A 5: 105,031,295 I113F probably damaging Het
Gm3095 A T 14: 3,964,463 R60S possibly damaging Het
Gpa33 A T 1: 166,152,694 M109L probably damaging Het
Grik2 A G 10: 49,535,397 L215P probably damaging Het
Gucy2g A C 19: 55,206,293 F897L probably damaging Het
Hinfp A G 9: 44,298,017 L295P probably damaging Het
Ift122 T C 6: 115,894,322 V526A probably benign Het
Ighv5-12 T C 12: 113,702,233 T82A probably benign Het
Il18rap T A 1: 40,524,951 S76R probably benign Het
Itga6 A T 2: 71,853,553 N1045I probably benign Het
Kctd21 A T 7: 97,347,763 I148F possibly damaging Het
Kif28 T A 1: 179,740,079 H42L probably benign Het
Kmt2c A C 5: 25,395,420 C326W probably damaging Het
Knl1 T A 2: 119,095,226 L1912* probably null Het
Lrfn1 A T 7: 28,459,522 I289F probably damaging Het
Lrriq1 T C 10: 103,221,324 K205R possibly damaging Het
Mbd5 A T 2: 49,257,554 N592I probably damaging Het
Mbl2 A G 19: 30,239,402 N205D possibly damaging Het
Mcm4 C A 16: 15,637,178 M1I probably null Het
Mgat4a T A 1: 37,454,784 H327L probably damaging Het
Miox A G 15: 89,335,003 D16G probably benign Het
Mvk C A 5: 114,455,978 P298Q possibly damaging Het
Nol6 A G 4: 41,118,699 L726P probably damaging Het
Nos1 T C 5: 117,949,815 I1381T probably benign Het
Nup98 A T 7: 102,134,937 S1063T probably benign Het
Obscn T G 11: 58,995,449 M7862L unknown Het
Obsl1 T C 1: 75,487,704 T1653A probably benign Het
Olfr1044 A G 2: 86,171,202 I205T probably benign Het
Olfr1202 G T 2: 88,817,343 M57I probably damaging Het
Olfr1497 C T 19: 13,794,994 V206I probably damaging Het
Olfr968 T A 9: 39,771,964 T279S probably benign Het
Pcdhb20 A G 18: 37,504,952 Y177C probably benign Het
Pcdhb3 A C 18: 37,301,604 I208L probably benign Het
Phlpp1 G T 1: 106,389,690 G1214W probably damaging Het
Ppp4r3a A T 12: 101,058,794 S149T possibly damaging Het
Pxdn T C 12: 30,002,439 C872R probably damaging Het
Rarb A G 14: 16,548,419 C101R probably damaging Het
Rcor3 A C 1: 192,127,983 V114G probably benign Het
Rnpepl1 A G 1: 92,919,650 Q653R probably benign Het
Rpap2 T A 5: 107,620,458 Y387* probably null Het
Rttn C T 18: 88,985,911 T343M possibly damaging Het
Samd11 T C 4: 156,248,773 T333A probably benign Het
Six5 T C 7: 19,095,043 L136P probably damaging Het
Slc12a5 T A 2: 164,982,932 M419K probably benign Het
Slc22a21 T C 11: 53,960,400 M179V probably benign Het
Slc35a4 A G 18: 36,680,517 D6G unknown Het
Spdye4c A T 2: 128,592,341 M1L probably benign Het
Svep1 A T 4: 58,069,699 C2696S possibly damaging Het
Tceanc2 T C 4: 107,147,696 N85S probably benign Het
Teddm2 A T 1: 153,850,597 L124Q probably damaging Het
Teddm2 G C 1: 153,850,598 L124V probably benign Het
Tgfbr1 T A 4: 47,405,623 W409R probably damaging Het
Tkt A G 14: 30,558,798 D62G probably damaging Het
Tnrc6b T A 15: 80,884,300 V1054D probably damaging Het
Trpm7 C A 2: 126,799,206 L1564F probably damaging Het
Vmn1r43 A T 6: 89,869,821 C228S probably benign Het
Vmn2r106 T C 17: 20,267,621 R839G probably damaging Het
Vwa3b C T 1: 37,114,597 Q507* probably null Het
Wrn C G 8: 33,248,966 W1278S probably benign Het
Zfp281 T G 1: 136,625,452 L56R probably damaging Het
Zfp407 G A 18: 84,561,536 T484I probably benign Het
Zfp451 T C 1: 33,813,762 T24A probably benign Het
Zfp607b T A 7: 27,693,494 F16I probably damaging Het
Zfp638 T A 6: 83,928,688 V41E possibly damaging Het
Other mutations in Vmn2r5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Vmn2r5 APN 3 64491413 missense possibly damaging 0.67
IGL01139:Vmn2r5 APN 3 64491405 missense probably benign 0.28
IGL03293:Vmn2r5 APN 3 64491326 missense probably benign 0.01
PIT4581001:Vmn2r5 UTSW 3 64503927 nonsense probably null
R0063:Vmn2r5 UTSW 3 64503800 missense probably benign 0.01
R0142:Vmn2r5 UTSW 3 64492588 missense probably damaging 1.00
R0193:Vmn2r5 UTSW 3 64491530 missense possibly damaging 0.91
R0219:Vmn2r5 UTSW 3 64504313 missense probably damaging 0.99
R0313:Vmn2r5 UTSW 3 64503827 missense probably benign
R0620:Vmn2r5 UTSW 3 64503814 nonsense probably null
R0726:Vmn2r5 UTSW 3 64503765 missense probably benign 0.01
R1073:Vmn2r5 UTSW 3 64491305 nonsense probably null
R1549:Vmn2r5 UTSW 3 64504000 missense probably damaging 1.00
R1581:Vmn2r5 UTSW 3 64491219 missense probably damaging 1.00
R1624:Vmn2r5 UTSW 3 64509695 missense probably benign 0.19
R1973:Vmn2r5 UTSW 3 64504221 missense probably damaging 1.00
R1974:Vmn2r5 UTSW 3 64504221 missense probably damaging 1.00
R1975:Vmn2r5 UTSW 3 64504221 missense probably damaging 1.00
R1977:Vmn2r5 UTSW 3 64504221 missense probably damaging 1.00
R2189:Vmn2r5 UTSW 3 64509593 missense probably benign 0.27
R2484:Vmn2r5 UTSW 3 64503971 missense possibly damaging 0.94
R4573:Vmn2r5 UTSW 3 64503918 missense probably damaging 0.98
R5243:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5384:Vmn2r5 UTSW 3 64509510 missense probably benign 0.02
R5385:Vmn2r5 UTSW 3 64509510 missense probably benign 0.02
R5587:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5588:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5589:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5590:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5739:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R6113:Vmn2r5 UTSW 3 64491399 missense probably benign 0.03
R6739:Vmn2r5 UTSW 3 64491216 missense probably damaging 0.97
R7106:Vmn2r5 UTSW 3 64491683 missense probably benign 0.05
R7304:Vmn2r5 UTSW 3 64504250 missense probably damaging 0.97
R7477:Vmn2r5 UTSW 3 64491639 missense probably damaging 1.00
R7571:Vmn2r5 UTSW 3 64504404 missense probably damaging 1.00
R7678:Vmn2r5 UTSW 3 64509522 missense probably benign
R7874:Vmn2r5 UTSW 3 64491032 missense probably damaging 1.00
R8110:Vmn2r5 UTSW 3 64491288 missense probably benign 0.00
R8223:Vmn2r5 UTSW 3 64491305 nonsense probably null
Z1088:Vmn2r5 UTSW 3 64509542 missense probably benign 0.02
Z1177:Vmn2r5 UTSW 3 64491051 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTACACTAAGGAAATTCATTTGG -3'
(R):5'- ATTGTCCACTGTCAAAAGTTACAG -3'

Sequencing Primer
(F):5'- GTCAGACCAACTAACCCTTG -3'
(R):5'- CTCTTCCTTATTAGCTATTGCCTTAC -3'
Posted On2019-09-13