Incidental Mutation 'R7402:Tgfbr1'
ID574246
Institutional Source Beutler Lab
Gene Symbol Tgfbr1
Ensembl Gene ENSMUSG00000007613
Gene Nametransforming growth factor, beta receptor I
SynonymsTbetaRI, ALK5, TbetaR-I, Alk-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7402 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location47353222-47414931 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47405623 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 409 (W409R)
Ref Sequence ENSEMBL: ENSMUSP00000007757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007757] [ENSMUST00000044234] [ENSMUST00000107725] [ENSMUST00000126171]
Predicted Effect probably damaging
Transcript: ENSMUST00000007757
AA Change: W409R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007757
Gene: ENSMUSG00000007613
AA Change: W409R

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 13 24 N/A INTRINSIC
Pfam:Activin_recp 30 110 2.7e-16 PFAM
transmembrane domain 126 148 N/A INTRINSIC
GS 175 205 1.01e-14 SMART
Blast:STYKc 207 492 7e-31 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000044234
AA Change: W405R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048501
Gene: ENSMUSG00000007613
AA Change: W405R

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 13 24 N/A INTRINSIC
Pfam:Activin_recp 30 110 1.6e-14 PFAM
transmembrane domain 122 144 N/A INTRINSIC
GS 171 201 1.01e-14 SMART
Blast:STYKc 203 488 8e-31 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000107725
AA Change: W326R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103353
Gene: ENSMUSG00000007613
AA Change: W326R

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
GS 92 122 1.01e-14 SMART
Blast:STYKc 124 409 3e-31 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000126171
AA Change: W340R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123761
Gene: ENSMUSG00000007613
AA Change: W340R

DomainStartEndE-ValueType
PDB:3KFD|L 1 45 3e-26 PDB
transmembrane domain 57 79 N/A INTRINSIC
GS 106 136 1.01e-14 SMART
Blast:STYKc 138 423 3e-31 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the transforming growth factor beta (TGF-beta) receptor family of proteins. These proteins comprise one component of the TGF-beta signaling pathway, which transduces extracellular signals into gene expression changes to regulate a wide range of cellular responses, including proliferation, migration, differentiation and apoptosis. Homozygous knockout mice for this gene exhibit impaired angiogenesis and embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for some targeted null mutations exhibit defects of the yolk sac and placenta, lack circulating erythrocytes, and die at midgestation. Mutant endothelial cells show enhanced proliferation, improper migration, and reduced fibronectin production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 G T 14: 118,706,075 P12Q probably damaging Het
Acsf3 A G 8: 122,780,424 Y152C probably damaging Het
Adam22 T A 5: 8,095,049 Q803L possibly damaging Het
Adamtsl3 G A 7: 82,578,617 V1337I probably damaging Het
Adra1b T C 11: 43,776,018 D464G possibly damaging Het
Alpk3 T A 7: 81,076,912 I115K probably benign Het
Amdhd2 A G 17: 24,161,683 S96P Het
Ankib1 T G 5: 3,769,586 D111A probably benign Het
Arhgef2 A G 3: 88,633,566 D216G probably damaging Het
Astn1 A T 1: 158,552,855 probably benign Het
Atrn T A 2: 130,947,600 W328R probably damaging Het
Atxn7 A T 14: 14,095,427 H375L probably damaging Het
BC003331 A G 1: 150,386,356 probably null Het
Btaf1 A T 19: 37,003,515 N1579Y probably damaging Het
Cacna1b A T 2: 24,607,659 L2079Q probably benign Het
Ccdc102a T C 8: 94,903,353 K520R probably damaging Het
Cd2ap T C 17: 42,805,163 H602R possibly damaging Het
Cdkn2aip A G 8: 47,711,373 V435A possibly damaging Het
Cenpf A T 1: 189,659,378 Y735* probably null Het
Cep350 T A 1: 155,928,215 I1041L probably benign Het
Ckap4 A G 10: 84,527,999 V400A probably damaging Het
Comp T A 8: 70,377,204 D359E probably benign Het
Coq10b A C 1: 55,061,341 K61N probably benign Het
Csmd2 A C 4: 128,322,095 S548R Het
Csmd2 G A 4: 128,322,096 S548N Het
Ctif A G 18: 75,611,736 I99T probably benign Het
Ctns T G 11: 73,193,077 T40P possibly damaging Het
Cyp11b1 C T 15: 74,840,825 R129H probably damaging Het
Cyp2c68 A T 19: 39,740,874 N56K probably benign Het
D6Wsu163e A G 6: 126,962,005 K401R probably damaging Het
Dstn T A 2: 143,938,448 C23S probably benign Het
Fam214a C A 9: 75,006,386 Y107* probably null Het
Fam72a A T 1: 131,538,875 E132D probably damaging Het
Fam72a G T 1: 131,538,876 E133* probably null Het
Gbp8 T A 5: 105,031,295 I113F probably damaging Het
Gm3095 A T 14: 3,964,463 R60S possibly damaging Het
Gpa33 A T 1: 166,152,694 M109L probably damaging Het
Grik2 A G 10: 49,535,397 L215P probably damaging Het
Gucy2g A C 19: 55,206,293 F897L probably damaging Het
Hinfp A G 9: 44,298,017 L295P probably damaging Het
Ift122 T C 6: 115,894,322 V526A probably benign Het
Ighv5-12 T C 12: 113,702,233 T82A probably benign Het
Il18rap T A 1: 40,524,951 S76R probably benign Het
Itga6 A T 2: 71,853,553 N1045I probably benign Het
Kctd21 A T 7: 97,347,763 I148F possibly damaging Het
Kif28 T A 1: 179,740,079 H42L probably benign Het
Kmt2c A C 5: 25,395,420 C326W probably damaging Het
Knl1 T A 2: 119,095,226 L1912* probably null Het
Lrfn1 A T 7: 28,459,522 I289F probably damaging Het
Lrriq1 T C 10: 103,221,324 K205R possibly damaging Het
Mbd5 A T 2: 49,257,554 N592I probably damaging Het
Mbl2 A G 19: 30,239,402 N205D possibly damaging Het
Mcm4 C A 16: 15,637,178 M1I probably null Het
Mgat4a T A 1: 37,454,784 H327L probably damaging Het
Miox A G 15: 89,335,003 D16G probably benign Het
Mvk C A 5: 114,455,978 P298Q possibly damaging Het
Nol6 A G 4: 41,118,699 L726P probably damaging Het
Nos1 T C 5: 117,949,815 I1381T probably benign Het
Nup98 A T 7: 102,134,937 S1063T probably benign Het
Obscn T G 11: 58,995,449 M7862L unknown Het
Obsl1 T C 1: 75,487,704 T1653A probably benign Het
Olfr1044 A G 2: 86,171,202 I205T probably benign Het
Olfr1202 G T 2: 88,817,343 M57I probably damaging Het
Olfr1497 C T 19: 13,794,994 V206I probably damaging Het
Olfr968 T A 9: 39,771,964 T279S probably benign Het
Pcdhb20 A G 18: 37,504,952 Y177C probably benign Het
Pcdhb3 A C 18: 37,301,604 I208L probably benign Het
Phlpp1 G T 1: 106,389,690 G1214W probably damaging Het
Ppp4r3a A T 12: 101,058,794 S149T possibly damaging Het
Pxdn T C 12: 30,002,439 C872R probably damaging Het
Rarb A G 14: 16,548,419 C101R probably damaging Het
Rcor3 A C 1: 192,127,983 V114G probably benign Het
Rnpepl1 A G 1: 92,919,650 Q653R probably benign Het
Rpap2 T A 5: 107,620,458 Y387* probably null Het
Rttn C T 18: 88,985,911 T343M possibly damaging Het
Samd11 T C 4: 156,248,773 T333A probably benign Het
Six5 T C 7: 19,095,043 L136P probably damaging Het
Slc12a5 T A 2: 164,982,932 M419K probably benign Het
Slc22a21 T C 11: 53,960,400 M179V probably benign Het
Slc35a4 A G 18: 36,680,517 D6G unknown Het
Spdye4c A T 2: 128,592,341 M1L probably benign Het
Svep1 A T 4: 58,069,699 C2696S possibly damaging Het
Tceanc2 T C 4: 107,147,696 N85S probably benign Het
Teddm2 A T 1: 153,850,597 L124Q probably damaging Het
Teddm2 G C 1: 153,850,598 L124V probably benign Het
Tkt A G 14: 30,558,798 D62G probably damaging Het
Tnrc6b T A 15: 80,884,300 V1054D probably damaging Het
Trpm7 C A 2: 126,799,206 L1564F probably damaging Het
Vmn1r43 A T 6: 89,869,821 C228S probably benign Het
Vmn2r106 T C 17: 20,267,621 R839G probably damaging Het
Vmn2r5 G A 3: 64,495,755 T523I probably benign Het
Vwa3b C T 1: 37,114,597 Q507* probably null Het
Wrn C G 8: 33,248,966 W1278S probably benign Het
Zfp281 T G 1: 136,625,452 L56R probably damaging Het
Zfp407 G A 18: 84,561,536 T484I probably benign Het
Zfp451 T C 1: 33,813,762 T24A probably benign Het
Zfp607b T A 7: 27,693,494 F16I probably damaging Het
Zfp638 T A 6: 83,928,688 V41E possibly damaging Het
Other mutations in Tgfbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Tgfbr1 APN 4 47383992 missense probably benign 0.00
IGL00757:Tgfbr1 APN 4 47405581 missense probably damaging 1.00
IGL02001:Tgfbr1 APN 4 47403388 missense probably damaging 1.00
IGL02207:Tgfbr1 APN 4 47410785 utr 3 prime probably benign
IGL02338:Tgfbr1 APN 4 47393490 critical splice donor site probably null
PIT4480001:Tgfbr1 UTSW 4 47402955 missense probably benign 0.44
R0097:Tgfbr1 UTSW 4 47403451 nonsense probably null
R0097:Tgfbr1 UTSW 4 47403451 nonsense probably null
R1299:Tgfbr1 UTSW 4 47396587 critical splice donor site probably null
R1444:Tgfbr1 UTSW 4 47393259 missense probably benign
R1530:Tgfbr1 UTSW 4 47410688 missense probably damaging 1.00
R1591:Tgfbr1 UTSW 4 47403471 missense probably damaging 1.00
R1611:Tgfbr1 UTSW 4 47396526 missense probably damaging 1.00
R2327:Tgfbr1 UTSW 4 47402833 missense probably damaging 1.00
R4352:Tgfbr1 UTSW 4 47402863 missense probably damaging 1.00
R4736:Tgfbr1 UTSW 4 47383835 missense probably benign
R5180:Tgfbr1 UTSW 4 47383948 nonsense probably null
R5907:Tgfbr1 UTSW 4 47396555 missense probably damaging 1.00
R6462:Tgfbr1 UTSW 4 47402846 missense probably damaging 1.00
R6842:Tgfbr1 UTSW 4 47383757 missense probably damaging 1.00
R7017:Tgfbr1 UTSW 4 47410728 missense probably damaging 0.99
R7206:Tgfbr1 UTSW 4 47402941 missense probably damaging 1.00
R7862:Tgfbr1 UTSW 4 47403489 missense probably damaging 0.99
R7945:Tgfbr1 UTSW 4 47403489 missense probably damaging 0.99
RF013:Tgfbr1 UTSW 4 47353354 missense unknown
Z1176:Tgfbr1 UTSW 4 47353790 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGAGACCCATGTGTTGACAC -3'
(R):5'- GATAAACTGTGTGTTGGCCG -3'

Sequencing Primer
(F):5'- GCCTAGTCTATATAGTGACACAGAC -3'
(R):5'- GCCGGATGATCTTTTGTTCTC -3'
Posted On2019-09-13