Incidental Mutation 'R7402:Tnrc6b'
ID574294
Institutional Source Beutler Lab
Gene Symbol Tnrc6b
Ensembl Gene ENSMUSG00000047888
Gene Nametrinucleotide repeat containing 6b
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R7402 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location80711313-80941085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80884300 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1054 (V1054D)
Ref Sequence ENSEMBL: ENSMUSP00000064336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067689] [ENSMUST00000227449]
Predicted Effect probably damaging
Transcript: ENSMUST00000067689
AA Change: V1054D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: V1054D

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
coiled coil region 33 72 N/A INTRINSIC
low complexity region 88 106 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 363 380 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
internal_repeat_1 488 667 6.43e-5 PROSPERO
low complexity region 858 888 N/A INTRINSIC
Pfam:Ago_hook 955 1095 1.2e-28 PFAM
coiled coil region 1258 1307 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1339 1623 2.8e-112 PFAM
Pfam:RRM_5 1641 1695 2e-7 PFAM
low complexity region 1705 1721 N/A INTRINSIC
low complexity region 1748 1769 N/A INTRINSIC
low complexity region 1792 1809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227449
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 G T 14: 118,706,075 P12Q probably damaging Het
Acsf3 A G 8: 122,780,424 Y152C probably damaging Het
Adam22 T A 5: 8,095,049 Q803L possibly damaging Het
Adamtsl3 G A 7: 82,578,617 V1337I probably damaging Het
Adra1b T C 11: 43,776,018 D464G possibly damaging Het
Alpk3 T A 7: 81,076,912 I115K probably benign Het
Amdhd2 A G 17: 24,161,683 S96P Het
Ankib1 T G 5: 3,769,586 D111A probably benign Het
Arhgef2 A G 3: 88,633,566 D216G probably damaging Het
Astn1 A T 1: 158,552,855 probably benign Het
Atrn T A 2: 130,947,600 W328R probably damaging Het
Atxn7 A T 14: 14,095,427 H375L probably damaging Het
BC003331 A G 1: 150,386,356 probably null Het
Btaf1 A T 19: 37,003,515 N1579Y probably damaging Het
Cacna1b A T 2: 24,607,659 L2079Q probably benign Het
Ccdc102a T C 8: 94,903,353 K520R probably damaging Het
Cd2ap T C 17: 42,805,163 H602R possibly damaging Het
Cdkn2aip A G 8: 47,711,373 V435A possibly damaging Het
Cenpf A T 1: 189,659,378 Y735* probably null Het
Cep350 T A 1: 155,928,215 I1041L probably benign Het
Ckap4 A G 10: 84,527,999 V400A probably damaging Het
Comp T A 8: 70,377,204 D359E probably benign Het
Coq10b A C 1: 55,061,341 K61N probably benign Het
Csmd2 A C 4: 128,322,095 S548R Het
Csmd2 G A 4: 128,322,096 S548N Het
Ctif A G 18: 75,611,736 I99T probably benign Het
Ctns T G 11: 73,193,077 T40P possibly damaging Het
Cyp11b1 C T 15: 74,840,825 R129H probably damaging Het
Cyp2c68 A T 19: 39,740,874 N56K probably benign Het
D6Wsu163e A G 6: 126,962,005 K401R probably damaging Het
Dstn T A 2: 143,938,448 C23S probably benign Het
Fam214a C A 9: 75,006,386 Y107* probably null Het
Fam72a A T 1: 131,538,875 E132D probably damaging Het
Fam72a G T 1: 131,538,876 E133* probably null Het
Gbp8 T A 5: 105,031,295 I113F probably damaging Het
Gm3095 A T 14: 3,964,463 R60S possibly damaging Het
Gpa33 A T 1: 166,152,694 M109L probably damaging Het
Grik2 A G 10: 49,535,397 L215P probably damaging Het
Gucy2g A C 19: 55,206,293 F897L probably damaging Het
Hinfp A G 9: 44,298,017 L295P probably damaging Het
Ift122 T C 6: 115,894,322 V526A probably benign Het
Ighv5-12 T C 12: 113,702,233 T82A probably benign Het
Il18rap T A 1: 40,524,951 S76R probably benign Het
Itga6 A T 2: 71,853,553 N1045I probably benign Het
Kctd21 A T 7: 97,347,763 I148F possibly damaging Het
Kif28 T A 1: 179,740,079 H42L probably benign Het
Kmt2c A C 5: 25,395,420 C326W probably damaging Het
Knl1 T A 2: 119,095,226 L1912* probably null Het
Lrfn1 A T 7: 28,459,522 I289F probably damaging Het
Lrriq1 T C 10: 103,221,324 K205R possibly damaging Het
Mbd5 A T 2: 49,257,554 N592I probably damaging Het
Mbl2 A G 19: 30,239,402 N205D possibly damaging Het
Mcm4 C A 16: 15,637,178 M1I probably null Het
Mgat4a T A 1: 37,454,784 H327L probably damaging Het
Miox A G 15: 89,335,003 D16G probably benign Het
Mvk C A 5: 114,455,978 P298Q possibly damaging Het
Nol6 A G 4: 41,118,699 L726P probably damaging Het
Nos1 T C 5: 117,949,815 I1381T probably benign Het
Nup98 A T 7: 102,134,937 S1063T probably benign Het
Obscn T G 11: 58,995,449 M7862L unknown Het
Obsl1 T C 1: 75,487,704 T1653A probably benign Het
Olfr1044 A G 2: 86,171,202 I205T probably benign Het
Olfr1202 G T 2: 88,817,343 M57I probably damaging Het
Olfr1497 C T 19: 13,794,994 V206I probably damaging Het
Olfr968 T A 9: 39,771,964 T279S probably benign Het
Pcdhb20 A G 18: 37,504,952 Y177C probably benign Het
Pcdhb3 A C 18: 37,301,604 I208L probably benign Het
Phlpp1 G T 1: 106,389,690 G1214W probably damaging Het
Ppp4r3a A T 12: 101,058,794 S149T possibly damaging Het
Pxdn T C 12: 30,002,439 C872R probably damaging Het
Rarb A G 14: 16,548,419 C101R probably damaging Het
Rcor3 A C 1: 192,127,983 V114G probably benign Het
Rnpepl1 A G 1: 92,919,650 Q653R probably benign Het
Rpap2 T A 5: 107,620,458 Y387* probably null Het
Rttn C T 18: 88,985,911 T343M possibly damaging Het
Samd11 T C 4: 156,248,773 T333A probably benign Het
Six5 T C 7: 19,095,043 L136P probably damaging Het
Slc12a5 T A 2: 164,982,932 M419K probably benign Het
Slc22a21 T C 11: 53,960,400 M179V probably benign Het
Slc35a4 A G 18: 36,680,517 D6G unknown Het
Spdye4c A T 2: 128,592,341 M1L probably benign Het
Svep1 A T 4: 58,069,699 C2696S possibly damaging Het
Tceanc2 T C 4: 107,147,696 N85S probably benign Het
Teddm2 A T 1: 153,850,597 L124Q probably damaging Het
Teddm2 G C 1: 153,850,598 L124V probably benign Het
Tgfbr1 T A 4: 47,405,623 W409R probably damaging Het
Tkt A G 14: 30,558,798 D62G probably damaging Het
Trpm7 C A 2: 126,799,206 L1564F probably damaging Het
Vmn1r43 A T 6: 89,869,821 C228S probably benign Het
Vmn2r106 T C 17: 20,267,621 R839G probably damaging Het
Vmn2r5 G A 3: 64,495,755 T523I probably benign Het
Vwa3b C T 1: 37,114,597 Q507* probably null Het
Wrn C G 8: 33,248,966 W1278S probably benign Het
Zfp281 T G 1: 136,625,452 L56R probably damaging Het
Zfp407 G A 18: 84,561,536 T484I probably benign Het
Zfp451 T C 1: 33,813,762 T24A probably benign Het
Zfp607b T A 7: 27,693,494 F16I probably damaging Het
Zfp638 T A 6: 83,928,688 V41E possibly damaging Het
Other mutations in Tnrc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Tnrc6b APN 15 80923578 missense probably damaging 1.00
IGL01402:Tnrc6b APN 15 80880544 missense possibly damaging 0.71
IGL01505:Tnrc6b APN 15 80879963 missense probably benign 0.00
IGL01516:Tnrc6b APN 15 80902622 missense possibly damaging 0.93
IGL01584:Tnrc6b APN 15 80879682 missense probably benign 0.01
IGL01681:Tnrc6b APN 15 80879311 unclassified probably null
IGL01909:Tnrc6b APN 15 80901983 missense possibly damaging 0.88
IGL01943:Tnrc6b APN 15 80927695 nonsense probably null
IGL02253:Tnrc6b APN 15 80876541 missense probably damaging 0.99
IGL02260:Tnrc6b APN 15 80880171 missense probably damaging 0.99
IGL02437:Tnrc6b APN 15 80880457 missense probably damaging 1.00
IGL02541:Tnrc6b APN 15 80879831 missense probably benign 0.00
IGL02542:Tnrc6b APN 15 80902352 missense possibly damaging 0.83
PIT1430001:Tnrc6b UTSW 15 80929186 missense probably damaging 0.99
R0092:Tnrc6b UTSW 15 80918528 missense probably damaging 1.00
R0165:Tnrc6b UTSW 15 80858670 splice site probably null
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0257:Tnrc6b UTSW 15 80894355 missense possibly damaging 0.80
R0418:Tnrc6b UTSW 15 80913323 missense probably benign 0.27
R0432:Tnrc6b UTSW 15 80923446 splice site probably benign
R0487:Tnrc6b UTSW 15 80880675 missense probably benign 0.01
R0498:Tnrc6b UTSW 15 80858719 missense probably damaging 0.98
R0528:Tnrc6b UTSW 15 80879403 missense probably benign 0.00
R0533:Tnrc6b UTSW 15 80876653 missense probably benign 0.00
R0571:Tnrc6b UTSW 15 80913338 missense probably damaging 1.00
R0650:Tnrc6b UTSW 15 80784758 missense probably benign 0.33
R0659:Tnrc6b UTSW 15 80923446 splice site probably benign
R0884:Tnrc6b UTSW 15 80902555 small deletion probably benign
R1131:Tnrc6b UTSW 15 80894453 missense possibly damaging 0.45
R1188:Tnrc6b UTSW 15 80879229 missense probably benign
R1479:Tnrc6b UTSW 15 80887032 unclassified probably null
R1564:Tnrc6b UTSW 15 80880168 missense possibly damaging 0.95
R1645:Tnrc6b UTSW 15 80882958 missense probably damaging 0.99
R1924:Tnrc6b UTSW 15 80884206 critical splice acceptor site probably null
R1926:Tnrc6b UTSW 15 80881162 missense probably damaging 1.00
R1928:Tnrc6b UTSW 15 80880723 missense probably damaging 1.00
R1965:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R1966:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R2072:Tnrc6b UTSW 15 80882965 missense possibly damaging 0.89
R3084:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3552:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3736:Tnrc6b UTSW 15 80889163 splice site probably benign
R3791:Tnrc6b UTSW 15 80923640 missense probably damaging 1.00
R4170:Tnrc6b UTSW 15 80916787 missense probably benign 0.24
R4276:Tnrc6b UTSW 15 80901971 missense probably benign 0.42
R4519:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R5380:Tnrc6b UTSW 15 80879565 missense possibly damaging 0.56
R5470:Tnrc6b UTSW 15 80916711 missense possibly damaging 0.89
R5590:Tnrc6b UTSW 15 80876502 missense probably damaging 0.98
R5982:Tnrc6b UTSW 15 80880816 missense probably benign
R6269:Tnrc6b UTSW 15 80880743 missense probably benign 0.42
R6331:Tnrc6b UTSW 15 80879614 missense probably benign 0.00
R6484:Tnrc6b UTSW 15 80879324 missense possibly damaging 0.92
R6622:Tnrc6b UTSW 15 80879184 missense probably damaging 0.99
R6695:Tnrc6b UTSW 15 80879773 missense probably damaging 1.00
R6728:Tnrc6b UTSW 15 80918526 missense probably damaging 1.00
R6776:Tnrc6b UTSW 15 80924119 missense possibly damaging 0.87
R7159:Tnrc6b UTSW 15 80887022 missense possibly damaging 0.92
R7210:Tnrc6b UTSW 15 80929285 missense probably damaging 1.00
R7287:Tnrc6b UTSW 15 80879541 missense possibly damaging 0.83
R7453:Tnrc6b UTSW 15 80902555 small deletion probably benign
R7479:Tnrc6b UTSW 15 80889126 missense probably benign 0.13
R7533:Tnrc6b UTSW 15 80927741 critical splice donor site probably null
R7571:Tnrc6b UTSW 15 80929393 missense probably benign
X0020:Tnrc6b UTSW 15 80882997 missense probably benign 0.16
X0025:Tnrc6b UTSW 15 80881167 missense probably benign 0.03
Z1088:Tnrc6b UTSW 15 80927690 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATTTGCCTTGTGTGTAGATGGAAC -3'
(R):5'- TACTCGGTGACTCCAGTTGC -3'

Sequencing Primer
(F):5'- CTGCAAAGATATTCAAATGCTGC -3'
(R):5'- GCCTCATTTCCTCCATGAACCAAG -3'
Posted On2019-09-13