Incidental Mutation 'R7403:Hycc2'
ID 574312
Institutional Source Beutler Lab
Gene Symbol Hycc2
Ensembl Gene ENSMUSG00000038174
Gene Name hyccin PI4KA lipid kinase complex subunit 2
Synonyms Fam126b, D1Ertd53e
MMRRC Submission 045485-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.865) question?
Stock # R7403 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 58561965-58625482 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 58587861 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 117 (D117E)
Ref Sequence ENSEMBL: ENSMUSP00000095331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038372] [ENSMUST00000097724] [ENSMUST00000161000] [ENSMUST00000161600] [ENSMUST00000187717]
AlphaFold Q8C729
Predicted Effect probably benign
Transcript: ENSMUST00000038372
AA Change: D117E

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000038718
Gene: ENSMUSG00000038174
AA Change: D117E

DomainStartEndE-ValueType
Pfam:Hyccin 20 330 1.7e-137 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000097724
AA Change: D117E

PolyPhen 2 Score 0.591 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000095331
Gene: ENSMUSG00000038174
AA Change: D117E

DomainStartEndE-ValueType
Pfam:Hyccin 22 330 3.3e-126 PFAM
low complexity region 374 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161000
SMART Domains Protein: ENSMUSP00000125653
Gene: ENSMUSG00000038174

DomainStartEndE-ValueType
Pfam:Hyccin 20 99 3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161600
AA Change: D117E

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000123728
Gene: ENSMUSG00000038174
AA Change: D117E

DomainStartEndE-ValueType
Pfam:Hyccin 20 330 1.7e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187717
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl2 G A 10: 83,450,059 (GRCm39) A271V probably benign Het
Brpf3 C T 17: 29,040,330 (GRCm39) T917I probably benign Het
Camta1 G A 4: 151,537,752 (GRCm39) Q143* probably null Het
Cd3e C A 9: 44,913,590 (GRCm39) E48D probably benign Het
Clca3b A G 3: 144,529,259 (GRCm39) L805P probably benign Het
Crispld1 A G 1: 17,817,820 (GRCm39) Y241C probably damaging Het
Ddx43 T G 9: 78,321,133 (GRCm39) N380K probably damaging Het
Dtl A T 1: 191,295,285 (GRCm39) V155E probably damaging Het
Eif1ad19 G T 12: 87,740,314 (GRCm39) Q82K probably benign Het
Elp1 A T 4: 56,778,994 (GRCm39) C608S probably damaging Het
Elp2 A G 18: 24,752,542 (GRCm39) H365R probably damaging Het
Fam78a T C 2: 31,959,627 (GRCm39) N161S probably damaging Het
Far2 T C 6: 148,060,475 (GRCm39) I276T possibly damaging Het
Frem3 T C 8: 81,342,774 (GRCm39) L1689P probably damaging Het
Gak T C 5: 108,761,401 (GRCm39) K210R probably benign Het
Gna14 G T 19: 16,576,445 (GRCm39) D151Y Het
Hdhd2 A G 18: 77,042,736 (GRCm39) D55G probably benign Het
Ifna5 A G 4: 88,754,110 (GRCm39) N117D probably benign Het
Il16 T A 7: 83,319,343 (GRCm39) T383S probably damaging Het
Il36rn T C 2: 24,171,214 (GRCm39) F101L probably damaging Het
Ino80d A G 1: 63,101,378 (GRCm39) V416A possibly damaging Het
Ints6 T C 14: 62,945,104 (GRCm39) R409G possibly damaging Het
Itgb5 G T 16: 33,723,163 (GRCm39) probably null Het
Itprid1 T A 6: 55,953,399 (GRCm39) L905* probably null Het
Kcnq3 T A 15: 65,874,066 (GRCm39) R561W probably damaging Het
Lipo4 C T 19: 33,480,679 (GRCm39) E230K possibly damaging Het
Lrrc7 A T 3: 157,854,311 (GRCm39) L1299* probably null Het
Mcm3ap T C 10: 76,318,657 (GRCm39) probably null Het
Mok A T 12: 110,781,563 (GRCm39) probably null Het
Mylk2 T A 2: 152,759,261 (GRCm39) V344E probably damaging Het
Oacyl T C 18: 65,870,966 (GRCm39) V389A probably benign Het
Oplah T C 15: 76,189,209 (GRCm39) D278G probably benign Het
Or1j8 T C 2: 36,192,342 (GRCm39) F264L probably benign Het
Or8s5 T C 15: 98,238,000 (GRCm39) Y290C probably damaging Het
Padi3 T C 4: 140,527,430 (GRCm39) N124D probably benign Het
Parp3 T C 9: 106,352,052 (GRCm39) S107G probably benign Het
Pcdhb18 G A 18: 37,624,950 (GRCm39) G760D probably benign Het
Plekhh1 G A 12: 79,087,351 (GRCm39) W13* probably null Het
Poglut3 T A 9: 53,301,741 (GRCm39) V131E probably damaging Het
Pou2f1 C T 1: 165,738,955 (GRCm39) A166T unknown Het
Ppp1r10 C T 17: 36,240,326 (GRCm39) P539S probably benign Het
Prdm11 T C 2: 92,817,036 (GRCm39) T310A probably benign Het
Rbm25 A G 12: 83,722,908 (GRCm39) Y777C probably damaging Het
Relt A T 7: 100,500,655 (GRCm39) C72S probably damaging Het
Rhag T A 17: 41,145,549 (GRCm39) I334N probably damaging Het
Rhbdf2 A C 11: 116,491,245 (GRCm39) L630R probably damaging Het
Rnps1 T C 17: 24,644,061 (GRCm39) S274P unknown Het
Rtkn2 A G 10: 67,841,466 (GRCm39) I205V probably benign Het
Ryr1 A T 7: 28,713,292 (GRCm39) V4690E probably benign Het
Secisbp2l T C 2: 125,602,199 (GRCm39) Y387C possibly damaging Het
Sema3d A T 5: 12,547,551 (GRCm39) I158F probably damaging Het
Slc17a1 A G 13: 24,058,690 (GRCm39) N48S probably benign Het
Slc2a1 G A 4: 118,989,752 (GRCm39) G130S probably damaging Het
Slc6a3 T C 13: 73,710,546 (GRCm39) probably null Het
Snx27 A T 3: 94,436,233 (GRCm39) S261T probably damaging Het
Spag17 A T 3: 99,846,691 (GRCm39) I72F possibly damaging Het
Spink6 T G 18: 44,204,564 (GRCm39) L10R unknown Het
Swt1 G A 1: 151,264,444 (GRCm39) T690I probably benign Het
Syne2 G A 12: 75,962,020 (GRCm39) E729K not run Het
Synj2 C T 17: 6,088,005 (GRCm39) T1352M possibly damaging Het
Taar4 G A 10: 23,836,957 (GRCm39) G189D probably damaging Het
Thsd4 T C 9: 59,964,170 (GRCm39) N441D probably damaging Het
Tm9sf2 A G 14: 122,378,640 (GRCm39) D248G probably benign Het
Tmem69 A T 4: 116,410,664 (GRCm39) L102Q probably damaging Het
Tshr A G 12: 91,464,548 (GRCm39) Y98C probably damaging Het
Tspan1 A G 4: 116,020,219 (GRCm39) V230A probably benign Het
Upk3a T C 15: 84,903,709 (GRCm39) V136A possibly damaging Het
Ush2a T A 1: 188,365,924 (GRCm39) N2259K probably damaging Het
Usp24 A G 4: 106,264,232 (GRCm39) D1721G possibly damaging Het
Vldlr T A 19: 27,213,674 (GRCm39) C120* probably null Het
Vmn2r23 A T 6: 123,681,538 (GRCm39) I149L probably benign Het
Vps8 A T 16: 21,253,722 (GRCm39) E21V possibly damaging Het
Wdr35 A G 12: 9,062,685 (GRCm39) I635V probably damaging Het
Zfp955a T C 17: 33,462,720 (GRCm39) D58G probably benign Het
Zkscan5 A G 5: 145,155,403 (GRCm39) Q358R probably benign Het
Other mutations in Hycc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Hycc2 APN 1 58,579,412 (GRCm39) splice site probably benign
IGL00468:Hycc2 APN 1 58,569,391 (GRCm39) missense probably benign 0.25
IGL00701:Hycc2 APN 1 58,574,641 (GRCm39) missense possibly damaging 0.59
IGL00795:Hycc2 APN 1 58,591,338 (GRCm39) missense probably damaging 1.00
IGL02023:Hycc2 APN 1 58,569,274 (GRCm39) missense possibly damaging 0.53
IGL02501:Hycc2 APN 1 58,579,350 (GRCm39) missense probably damaging 1.00
IGL02657:Hycc2 APN 1 58,574,561 (GRCm39) missense probably damaging 1.00
IGL02970:Hycc2 APN 1 58,578,776 (GRCm39) missense probably damaging 1.00
IGL03221:Hycc2 APN 1 58,579,345 (GRCm39) missense probably benign 0.00
IGL03240:Hycc2 APN 1 58,569,076 (GRCm39) missense probably damaging 1.00
PIT4812001:Hycc2 UTSW 1 58,587,862 (GRCm39) missense possibly damaging 0.78
R0455:Hycc2 UTSW 1 58,573,638 (GRCm39) splice site probably benign
R1479:Hycc2 UTSW 1 58,591,427 (GRCm39) nonsense probably null
R1529:Hycc2 UTSW 1 58,578,766 (GRCm39) missense probably benign 0.00
R4275:Hycc2 UTSW 1 58,569,092 (GRCm39) missense probably benign
R5164:Hycc2 UTSW 1 58,574,597 (GRCm39) missense probably benign 0.13
R6332:Hycc2 UTSW 1 58,569,034 (GRCm39) missense probably damaging 0.99
R6352:Hycc2 UTSW 1 58,596,471 (GRCm39) missense probably damaging 1.00
R6549:Hycc2 UTSW 1 58,578,759 (GRCm39) missense probably benign 0.03
R7034:Hycc2 UTSW 1 58,574,696 (GRCm39) missense probably benign 0.17
R7036:Hycc2 UTSW 1 58,574,696 (GRCm39) missense probably benign 0.17
R7100:Hycc2 UTSW 1 58,573,653 (GRCm39) missense possibly damaging 0.94
R7237:Hycc2 UTSW 1 58,569,107 (GRCm39) nonsense probably null
R7378:Hycc2 UTSW 1 58,569,193 (GRCm39) missense probably benign 0.00
R8015:Hycc2 UTSW 1 58,574,641 (GRCm39) missense possibly damaging 0.59
R8249:Hycc2 UTSW 1 58,573,796 (GRCm39) missense probably benign 0.10
R8544:Hycc2 UTSW 1 58,568,981 (GRCm39) missense probably benign 0.09
R8726:Hycc2 UTSW 1 58,585,285 (GRCm39) missense possibly damaging 0.82
R8829:Hycc2 UTSW 1 58,587,832 (GRCm39) missense possibly damaging 0.86
R8832:Hycc2 UTSW 1 58,587,832 (GRCm39) missense possibly damaging 0.86
R8847:Hycc2 UTSW 1 58,595,713 (GRCm39) missense probably damaging 1.00
R9046:Hycc2 UTSW 1 58,568,945 (GRCm39) missense probably damaging 0.99
R9177:Hycc2 UTSW 1 58,591,361 (GRCm39) missense probably damaging 1.00
R9268:Hycc2 UTSW 1 58,591,361 (GRCm39) missense probably damaging 1.00
R9472:Hycc2 UTSW 1 58,574,641 (GRCm39) missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- AGAAGACAATGTATTAGGGCCC -3'
(R):5'- CTGACAGATTTGGAAGACTATGC -3'

Sequencing Primer
(F):5'- CCTTTCACTTGGAAGCAGAGTCAG -3'
(R):5'- ACAGATTTGGAAGACTATGCTAGAG -3'
Posted On 2019-09-13