Incidental Mutation 'R7403:Dtl'
ID574317
Institutional Source Beutler Lab
Gene Symbol Dtl
Ensembl Gene ENSMUSG00000037474
Gene Namedenticleless E3 ubiquitin protein ligase
Synonyms5730564G15Rik, 2810047L02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7403 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location191537356-191575544 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 191563173 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 155 (V155E)
Ref Sequence ENSEMBL: ENSMUSP00000027933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027933] [ENSMUST00000193977] [ENSMUST00000195650]
Predicted Effect probably damaging
Transcript: ENSMUST00000027933
AA Change: V155E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027933
Gene: ENSMUSG00000037474
AA Change: V155E

DomainStartEndE-ValueType
Blast:WD40 30 80 1e-24 BLAST
WD40 87 126 2.61e-3 SMART
WD40 129 169 8.04e-4 SMART
WD40 205 244 8.29e-1 SMART
Blast:WD40 265 299 1e-11 BLAST
WD40 304 345 1.29e-2 SMART
WD40 349 389 1.07e-8 SMART
low complexity region 427 454 N/A INTRINSIC
low complexity region 476 495 N/A INTRINSIC
low complexity region 505 521 N/A INTRINSIC
low complexity region 630 645 N/A INTRINSIC
low complexity region 674 690 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193977
SMART Domains Protein: ENSMUSP00000142111
Gene: ENSMUSG00000037474

DomainStartEndE-ValueType
Blast:WD40 30 80 1e-26 BLAST
SCOP:d1e1aa_ 65 108 6e-5 SMART
Blast:WD40 87 113 6e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195650
SMART Domains Protein: ENSMUSP00000141218
Gene: ENSMUSG00000037474

DomainStartEndE-ValueType
Blast:WD40 30 80 2e-26 BLAST
WD40 87 126 1.6e-5 SMART
Blast:WD40 129 154 7e-10 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutation of this gene results in very early embryonic lethality around or before E1.5. In vitro siRNA knockdown experiments show that the gene is essential cell survival and cell cycle progression to allow proper blastocyst formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl2 G A 10: 83,614,195 A271V probably benign Het
Brpf3 C T 17: 28,821,356 T917I probably benign Het
Camta1 G A 4: 151,453,295 Q143* probably null Het
Ccdc129 T A 6: 55,976,414 L905* probably null Het
Cd3e C A 9: 45,002,292 E48D probably benign Het
Clca3b A G 3: 144,823,498 L805P probably benign Het
Crispld1 A G 1: 17,747,596 Y241C probably damaging Het
Ddx43 T G 9: 78,413,851 N380K probably damaging Het
Elp2 A G 18: 24,619,485 H365R probably damaging Het
Fam126b A T 1: 58,548,702 D117E possibly damaging Het
Fam78a T C 2: 32,069,615 N161S probably damaging Het
Far2 T C 6: 148,158,977 I276T possibly damaging Het
Frem3 T C 8: 80,616,145 L1689P probably damaging Het
Gak T C 5: 108,613,535 K210R probably benign Het
Gm21319 G T 12: 87,773,544 Q82K probably benign Het
Gna14 G T 19: 16,599,081 D151Y Het
Hdhd2 A G 18: 76,955,040 D55G probably benign Het
Ifna5 A G 4: 88,835,873 N117D probably benign Het
Ikbkap A T 4: 56,778,994 C608S probably damaging Het
Il16 T A 7: 83,670,135 T383S probably damaging Het
Il1f5 T C 2: 24,281,202 F101L probably damaging Het
Ino80d A G 1: 63,062,219 V416A possibly damaging Het
Ints6 T C 14: 62,707,655 R409G possibly damaging Het
Itgb5 G T 16: 33,902,793 probably null Het
Kcnq3 T A 15: 66,002,217 R561W probably damaging Het
Kdelc2 T A 9: 53,390,441 V131E probably damaging Het
Lipo4 C T 19: 33,503,279 E230K possibly damaging Het
Lrrc7 A T 3: 158,148,674 L1299* probably null Het
Mcm3ap T C 10: 76,482,823 probably null Het
Mok A T 12: 110,815,129 probably null Het
Mylk2 T A 2: 152,917,341 V344E probably damaging Het
Oacyl T C 18: 65,737,895 V389A probably benign Het
Olfr284 T C 15: 98,340,119 Y290C probably damaging Het
Olfr335-ps T C 2: 36,302,330 F264L probably benign Het
Oplah T C 15: 76,305,009 D278G probably benign Het
Padi3 T C 4: 140,800,119 N124D probably benign Het
Parp3 T C 9: 106,474,853 S107G probably benign Het
Pcdhb18 G A 18: 37,491,897 G760D probably benign Het
Plekhh1 G A 12: 79,040,577 W13* probably null Het
Pou2f1 C T 1: 165,911,386 A166T unknown Het
Ppp1r10 C T 17: 35,929,434 P539S probably benign Het
Prdm11 T C 2: 92,986,691 T310A probably benign Het
Rbm25 A G 12: 83,676,134 Y777C probably damaging Het
Relt A T 7: 100,851,448 C72S probably damaging Het
Rhag T A 17: 40,834,658 I334N probably damaging Het
Rhbdf2 A C 11: 116,600,419 L630R probably damaging Het
Rnps1 T C 17: 24,425,087 S274P unknown Het
Rtkn2 A G 10: 68,005,636 I205V probably benign Het
Ryr1 A T 7: 29,013,867 V4690E probably benign Het
Secisbp2l T C 2: 125,760,279 Y387C possibly damaging Het
Sema3d A T 5: 12,497,584 I158F probably damaging Het
Slc17a1 A G 13: 23,874,707 N48S probably benign Het
Slc2a1 G A 4: 119,132,555 G130S probably damaging Het
Slc6a3 T C 13: 73,562,427 probably null Het
Snx27 A T 3: 94,528,926 S261T probably damaging Het
Spag17 A T 3: 99,939,375 I72F possibly damaging Het
Spink6 T G 18: 44,071,497 L10R unknown Het
Swt1 G A 1: 151,388,693 T690I probably benign Het
Syne2 G A 12: 75,915,246 E729K not run Het
Synj2 C T 17: 6,037,730 T1352M possibly damaging Het
Taar4 G A 10: 23,961,059 G189D probably damaging Het
Thsd4 T C 9: 60,056,887 N441D probably damaging Het
Tm9sf2 A G 14: 122,141,228 D248G probably benign Het
Tmem69 A T 4: 116,553,467 L102Q probably damaging Het
Tshr A G 12: 91,497,774 Y98C probably damaging Het
Tspan1 A G 4: 116,163,022 V230A probably benign Het
Upk3a T C 15: 85,019,508 V136A possibly damaging Het
Ush2a T A 1: 188,633,727 N2259K probably damaging Het
Usp24 A G 4: 106,407,035 D1721G possibly damaging Het
Vldlr T A 19: 27,236,274 C120* probably null Het
Vmn2r23 A T 6: 123,704,579 I149L probably benign Het
Vps8 A T 16: 21,434,972 E21V possibly damaging Het
Wdr35 A G 12: 9,012,685 I635V probably damaging Het
Zfp955a T C 17: 33,243,746 D58G probably benign Het
Zkscan5 A G 5: 145,218,593 Q358R probably benign Het
Other mutations in Dtl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Dtl APN 1 191546626 splice site probably null
IGL01069:Dtl APN 1 191561539 critical splice acceptor site probably null
IGL01135:Dtl APN 1 191548330 missense probably damaging 1.00
IGL01307:Dtl APN 1 191570699 missense possibly damaging 0.78
IGL01461:Dtl APN 1 191546617 missense possibly damaging 0.88
IGL01809:Dtl APN 1 191548303 missense probably damaging 1.00
IGL01958:Dtl APN 1 191568377 missense probably damaging 1.00
IGL02217:Dtl APN 1 191568314 missense probably damaging 1.00
IGL02408:Dtl APN 1 191541240 missense probably benign 0.00
IGL02445:Dtl APN 1 191558060 critical splice donor site probably null
IGL02661:Dtl APN 1 191541371 missense probably benign 0.09
IGL02864:Dtl APN 1 191556826 missense probably benign 0.04
IGL02897:Dtl APN 1 191541544 splice site probably benign
IGL03069:Dtl APN 1 191556896 splice site probably benign
PIT4418001:Dtl UTSW 1 191541317 missense possibly damaging 0.46
R0370:Dtl UTSW 1 191575350 missense probably benign 0.05
R0513:Dtl UTSW 1 191569707 nonsense probably null
R1386:Dtl UTSW 1 191569717 missense probably damaging 1.00
R1424:Dtl UTSW 1 191561537 missense probably benign 0.13
R1575:Dtl UTSW 1 191561546 splice site probably null
R2128:Dtl UTSW 1 191558110 missense probably damaging 0.99
R2297:Dtl UTSW 1 191541095 missense probably benign 0.41
R2344:Dtl UTSW 1 191548378 missense probably benign 0.00
R3121:Dtl UTSW 1 191553063 nonsense probably null
R3808:Dtl UTSW 1 191548354 missense probably damaging 1.00
R4722:Dtl UTSW 1 191556841 missense possibly damaging 0.52
R4753:Dtl UTSW 1 191569703 missense probably damaging 1.00
R4904:Dtl UTSW 1 191568345 missense probably damaging 0.99
R4965:Dtl UTSW 1 191546565 missense possibly damaging 0.93
R5068:Dtl UTSW 1 191568373 missense probably damaging 1.00
R5119:Dtl UTSW 1 191541506 missense probably damaging 1.00
R5872:Dtl UTSW 1 191546568 missense probably benign 0.00
R5911:Dtl UTSW 1 191568407 missense probably damaging 1.00
R5992:Dtl UTSW 1 191568572 intron probably null
R6425:Dtl UTSW 1 191546623 missense probably benign 0.02
X0018:Dtl UTSW 1 191568410 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTGAGACTTGAGCAGGAAG -3'
(R):5'- TAGATTGGCAGGCACATTGAG -3'

Sequencing Primer
(F):5'- CTTGAGCAGGAAGGGAACAC -3'
(R):5'- TAATGTGTGAGAACTGTGTAGAGC -3'
Posted On2019-09-13