Incidental Mutation 'R7403:Mylk2'
ID574323
Institutional Source Beutler Lab
Gene Symbol Mylk2
Ensembl Gene ENSMUSG00000027470
Gene Namemyosin, light polypeptide kinase 2, skeletal muscle
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R7403 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location152911352-152923068 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 152917341 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 344 (V344E)
Ref Sequence ENSEMBL: ENSMUSP00000028970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028970]
Predicted Effect probably damaging
Transcript: ENSMUST00000028970
AA Change: V344E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028970
Gene: ENSMUSG00000027470
AA Change: V344E

DomainStartEndE-ValueType
low complexity region 90 122 N/A INTRINSIC
low complexity region 142 157 N/A INTRINSIC
low complexity region 216 228 N/A INTRINSIC
low complexity region 278 285 N/A INTRINSIC
S_TKc 302 557 6.08e-87 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a myosin light chain kinase, a calcium/calmodulin dependent enzyme, that is exclusively expressed in adult skeletal muscle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout mice display impaired skeletal muscle twitch tension response to tetanic stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl2 G A 10: 83,614,195 A271V probably benign Het
Brpf3 C T 17: 28,821,356 T917I probably benign Het
Camta1 G A 4: 151,453,295 Q143* probably null Het
Ccdc129 T A 6: 55,976,414 L905* probably null Het
Cd3e C A 9: 45,002,292 E48D probably benign Het
Clca3b A G 3: 144,823,498 L805P probably benign Het
Crispld1 A G 1: 17,747,596 Y241C probably damaging Het
Ddx43 T G 9: 78,413,851 N380K probably damaging Het
Dtl A T 1: 191,563,173 V155E probably damaging Het
Elp2 A G 18: 24,619,485 H365R probably damaging Het
Fam126b A T 1: 58,548,702 D117E possibly damaging Het
Fam78a T C 2: 32,069,615 N161S probably damaging Het
Far2 T C 6: 148,158,977 I276T possibly damaging Het
Frem3 T C 8: 80,616,145 L1689P probably damaging Het
Gak T C 5: 108,613,535 K210R probably benign Het
Gm21319 G T 12: 87,773,544 Q82K probably benign Het
Gna14 G T 19: 16,599,081 D151Y Het
Hdhd2 A G 18: 76,955,040 D55G probably benign Het
Ifna5 A G 4: 88,835,873 N117D probably benign Het
Ikbkap A T 4: 56,778,994 C608S probably damaging Het
Il16 T A 7: 83,670,135 T383S probably damaging Het
Il1f5 T C 2: 24,281,202 F101L probably damaging Het
Ino80d A G 1: 63,062,219 V416A possibly damaging Het
Ints6 T C 14: 62,707,655 R409G possibly damaging Het
Itgb5 G T 16: 33,902,793 probably null Het
Kcnq3 T A 15: 66,002,217 R561W probably damaging Het
Kdelc2 T A 9: 53,390,441 V131E probably damaging Het
Lipo4 C T 19: 33,503,279 E230K possibly damaging Het
Lrrc7 A T 3: 158,148,674 L1299* probably null Het
Mcm3ap T C 10: 76,482,823 probably null Het
Mok A T 12: 110,815,129 probably null Het
Oacyl T C 18: 65,737,895 V389A probably benign Het
Olfr284 T C 15: 98,340,119 Y290C probably damaging Het
Olfr335-ps T C 2: 36,302,330 F264L probably benign Het
Oplah T C 15: 76,305,009 D278G probably benign Het
Padi3 T C 4: 140,800,119 N124D probably benign Het
Parp3 T C 9: 106,474,853 S107G probably benign Het
Pcdhb18 G A 18: 37,491,897 G760D probably benign Het
Plekhh1 G A 12: 79,040,577 W13* probably null Het
Pou2f1 C T 1: 165,911,386 A166T unknown Het
Ppp1r10 C T 17: 35,929,434 P539S probably benign Het
Prdm11 T C 2: 92,986,691 T310A probably benign Het
Rbm25 A G 12: 83,676,134 Y777C probably damaging Het
Relt A T 7: 100,851,448 C72S probably damaging Het
Rhag T A 17: 40,834,658 I334N probably damaging Het
Rhbdf2 A C 11: 116,600,419 L630R probably damaging Het
Rnps1 T C 17: 24,425,087 S274P unknown Het
Rtkn2 A G 10: 68,005,636 I205V probably benign Het
Ryr1 A T 7: 29,013,867 V4690E probably benign Het
Secisbp2l T C 2: 125,760,279 Y387C possibly damaging Het
Sema3d A T 5: 12,497,584 I158F probably damaging Het
Slc17a1 A G 13: 23,874,707 N48S probably benign Het
Slc2a1 G A 4: 119,132,555 G130S probably damaging Het
Slc6a3 T C 13: 73,562,427 probably null Het
Snx27 A T 3: 94,528,926 S261T probably damaging Het
Spag17 A T 3: 99,939,375 I72F possibly damaging Het
Spink6 T G 18: 44,071,497 L10R unknown Het
Swt1 G A 1: 151,388,693 T690I probably benign Het
Syne2 G A 12: 75,915,246 E729K not run Het
Synj2 C T 17: 6,037,730 T1352M possibly damaging Het
Taar4 G A 10: 23,961,059 G189D probably damaging Het
Thsd4 T C 9: 60,056,887 N441D probably damaging Het
Tm9sf2 A G 14: 122,141,228 D248G probably benign Het
Tmem69 A T 4: 116,553,467 L102Q probably damaging Het
Tshr A G 12: 91,497,774 Y98C probably damaging Het
Tspan1 A G 4: 116,163,022 V230A probably benign Het
Upk3a T C 15: 85,019,508 V136A possibly damaging Het
Ush2a T A 1: 188,633,727 N2259K probably damaging Het
Usp24 A G 4: 106,407,035 D1721G possibly damaging Het
Vldlr T A 19: 27,236,274 C120* probably null Het
Vmn2r23 A T 6: 123,704,579 I149L probably benign Het
Vps8 A T 16: 21,434,972 E21V possibly damaging Het
Wdr35 A G 12: 9,012,685 I635V probably damaging Het
Zfp955a T C 17: 33,243,746 D58G probably benign Het
Zkscan5 A G 5: 145,218,593 Q358R probably benign Het
Other mutations in Mylk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01870:Mylk2 APN 2 152915214 missense probably benign 0.20
IGL02097:Mylk2 APN 2 152915136 missense probably damaging 0.98
IGL02158:Mylk2 APN 2 152919157 missense probably damaging 1.00
IGL02189:Mylk2 APN 2 152915154 missense probably damaging 1.00
IGL02243:Mylk2 APN 2 152920553 missense probably damaging 1.00
IGL02716:Mylk2 APN 2 152922153 makesense probably null
IGL02946:Mylk2 APN 2 152919210 nonsense probably null
IGL03105:Mylk2 APN 2 152917359 missense possibly damaging 0.94
R1184:Mylk2 UTSW 2 152913741 critical splice donor site probably null
R1443:Mylk2 UTSW 2 152919416 missense probably damaging 1.00
R1957:Mylk2 UTSW 2 152917607 missense possibly damaging 0.86
R2496:Mylk2 UTSW 2 152913668 missense probably damaging 1.00
R2870:Mylk2 UTSW 2 152919348 missense probably damaging 1.00
R2870:Mylk2 UTSW 2 152919348 missense probably damaging 1.00
R3081:Mylk2 UTSW 2 152919354 missense probably benign 0.31
R4510:Mylk2 UTSW 2 152917410 missense probably damaging 1.00
R4511:Mylk2 UTSW 2 152917410 missense probably damaging 1.00
R4600:Mylk2 UTSW 2 152917556 missense probably damaging 1.00
R4633:Mylk2 UTSW 2 152917415 missense probably benign 0.00
R4890:Mylk2 UTSW 2 152920354 missense possibly damaging 0.88
R5267:Mylk2 UTSW 2 152913549 missense probably benign
R5430:Mylk2 UTSW 2 152917548 missense probably damaging 1.00
R5447:Mylk2 UTSW 2 152912510 missense probably damaging 0.96
R6167:Mylk2 UTSW 2 152915753 splice site probably null
R6327:Mylk2 UTSW 2 152913693 missense possibly damaging 0.77
R6391:Mylk2 UTSW 2 152917395 missense probably damaging 1.00
R6913:Mylk2 UTSW 2 152913690 missense possibly damaging 0.76
R7066:Mylk2 UTSW 2 152911668 intron probably null
R7092:Mylk2 UTSW 2 152915190 missense probably benign 0.21
R7442:Mylk2 UTSW 2 152911426 start gained probably benign
R7443:Mylk2 UTSW 2 152911426 start gained probably benign
R7453:Mylk2 UTSW 2 152912433 missense probably damaging 1.00
R7477:Mylk2 UTSW 2 152920341 missense probably damaging 1.00
R7529:Mylk2 UTSW 2 152915704 missense probably damaging 1.00
R8029:Mylk2 UTSW 2 152920299 missense probably damaging 1.00
Z1177:Mylk2 UTSW 2 152920330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGAAACTGATCCCACCTG -3'
(R):5'- ATGGTAGTCTTCATCCACAATCCTC -3'

Sequencing Primer
(F):5'- TGCCTACGACCCAGTTATAGC -3'
(R):5'- TCCTCTCAAAGAGCTCGCCG -3'
Posted On2019-09-13