Incidental Mutation 'R7403:Snx27'
ID574324
Institutional Source Beutler Lab
Gene Symbol Snx27
Ensembl Gene ENSMUSG00000028136
Gene Namesorting nexin family member 27
SynonymsESTM47, 5730552M22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7403 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location94497544-94582716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94528926 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 261 (S261T)
Ref Sequence ENSEMBL: ENSMUSP00000102904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029783] [ENSMUST00000107283] [ENSMUST00000198426] [ENSMUST00000199462] [ENSMUST00000200642]
Predicted Effect probably benign
Transcript: ENSMUST00000029783
AA Change: S261T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000029783
Gene: ENSMUSG00000028136
AA Change: S261T

DomainStartEndE-ValueType
low complexity region 18 38 N/A INTRINSIC
PDZ 49 134 3.77e-19 SMART
PX 154 263 7.5e-21 SMART
Pfam:RA 271 360 1.2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107283
AA Change: S261T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102904
Gene: ENSMUSG00000028136
AA Change: S261T

DomainStartEndE-ValueType
low complexity region 18 38 N/A INTRINSIC
PDZ 49 134 3.77e-19 SMART
PX 154 263 7.5e-21 SMART
Pfam:RA 271 360 1.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198426
AA Change: S91T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000143525
Gene: ENSMUSG00000028136
AA Change: S91T

DomainStartEndE-ValueType
PX 1 93 5.11e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199462
SMART Domains Protein: ENSMUSP00000143378
Gene: ENSMUSG00000028136

DomainStartEndE-ValueType
low complexity region 18 38 N/A INTRINSIC
PDB:3QE1|A 39 58 9e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000200642
AA Change: S170T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000143066
Gene: ENSMUSG00000028136
AA Change: S170T

DomainStartEndE-ValueType
PDB:3QGL|E 12 42 3e-12 PDB
PX 63 172 7.5e-21 SMART
Pfam:RA 180 269 5.3e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family, a diverse group of cytoplasmic and membrane-associated proteins involved in endocytosis of plasma membrane receptors and protein trafficking through these compartments. All members of this protein family contain a phosphoinositide binding domain (PX domain). A highly similar protein in mouse is responsible for the specific recruitment of an isoform of serotonin 5-hydroxytryptamine 4 receptor into early endosomes, suggesting the analogous role for the human protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal and postnatal lethality, decreased organ size, slow postnatal weight gain, and decreased endocytosis of Grin2c. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl2 G A 10: 83,614,195 A271V probably benign Het
Brpf3 C T 17: 28,821,356 T917I probably benign Het
Camta1 G A 4: 151,453,295 Q143* probably null Het
Ccdc129 T A 6: 55,976,414 L905* probably null Het
Cd3e C A 9: 45,002,292 E48D probably benign Het
Clca3b A G 3: 144,823,498 L805P probably benign Het
Crispld1 A G 1: 17,747,596 Y241C probably damaging Het
Ddx43 T G 9: 78,413,851 N380K probably damaging Het
Dtl A T 1: 191,563,173 V155E probably damaging Het
Elp2 A G 18: 24,619,485 H365R probably damaging Het
Fam126b A T 1: 58,548,702 D117E possibly damaging Het
Fam78a T C 2: 32,069,615 N161S probably damaging Het
Far2 T C 6: 148,158,977 I276T possibly damaging Het
Frem3 T C 8: 80,616,145 L1689P probably damaging Het
Gak T C 5: 108,613,535 K210R probably benign Het
Gm21319 G T 12: 87,773,544 Q82K probably benign Het
Gna14 G T 19: 16,599,081 D151Y Het
Hdhd2 A G 18: 76,955,040 D55G probably benign Het
Ifna5 A G 4: 88,835,873 N117D probably benign Het
Ikbkap A T 4: 56,778,994 C608S probably damaging Het
Il16 T A 7: 83,670,135 T383S probably damaging Het
Il1f5 T C 2: 24,281,202 F101L probably damaging Het
Ino80d A G 1: 63,062,219 V416A possibly damaging Het
Ints6 T C 14: 62,707,655 R409G possibly damaging Het
Itgb5 G T 16: 33,902,793 probably null Het
Kcnq3 T A 15: 66,002,217 R561W probably damaging Het
Kdelc2 T A 9: 53,390,441 V131E probably damaging Het
Lipo4 C T 19: 33,503,279 E230K possibly damaging Het
Lrrc7 A T 3: 158,148,674 L1299* probably null Het
Mcm3ap T C 10: 76,482,823 probably null Het
Mok A T 12: 110,815,129 probably null Het
Mylk2 T A 2: 152,917,341 V344E probably damaging Het
Oacyl T C 18: 65,737,895 V389A probably benign Het
Olfr284 T C 15: 98,340,119 Y290C probably damaging Het
Olfr335-ps T C 2: 36,302,330 F264L probably benign Het
Oplah T C 15: 76,305,009 D278G probably benign Het
Padi3 T C 4: 140,800,119 N124D probably benign Het
Parp3 T C 9: 106,474,853 S107G probably benign Het
Pcdhb18 G A 18: 37,491,897 G760D probably benign Het
Plekhh1 G A 12: 79,040,577 W13* probably null Het
Pou2f1 C T 1: 165,911,386 A166T unknown Het
Ppp1r10 C T 17: 35,929,434 P539S probably benign Het
Prdm11 T C 2: 92,986,691 T310A probably benign Het
Rbm25 A G 12: 83,676,134 Y777C probably damaging Het
Relt A T 7: 100,851,448 C72S probably damaging Het
Rhag T A 17: 40,834,658 I334N probably damaging Het
Rhbdf2 A C 11: 116,600,419 L630R probably damaging Het
Rnps1 T C 17: 24,425,087 S274P unknown Het
Rtkn2 A G 10: 68,005,636 I205V probably benign Het
Ryr1 A T 7: 29,013,867 V4690E probably benign Het
Secisbp2l T C 2: 125,760,279 Y387C possibly damaging Het
Sema3d A T 5: 12,497,584 I158F probably damaging Het
Slc17a1 A G 13: 23,874,707 N48S probably benign Het
Slc2a1 G A 4: 119,132,555 G130S probably damaging Het
Slc6a3 T C 13: 73,562,427 probably null Het
Spag17 A T 3: 99,939,375 I72F possibly damaging Het
Spink6 T G 18: 44,071,497 L10R unknown Het
Swt1 G A 1: 151,388,693 T690I probably benign Het
Syne2 G A 12: 75,915,246 E729K not run Het
Synj2 C T 17: 6,037,730 T1352M possibly damaging Het
Taar4 G A 10: 23,961,059 G189D probably damaging Het
Thsd4 T C 9: 60,056,887 N441D probably damaging Het
Tm9sf2 A G 14: 122,141,228 D248G probably benign Het
Tmem69 A T 4: 116,553,467 L102Q probably damaging Het
Tshr A G 12: 91,497,774 Y98C probably damaging Het
Tspan1 A G 4: 116,163,022 V230A probably benign Het
Upk3a T C 15: 85,019,508 V136A possibly damaging Het
Ush2a T A 1: 188,633,727 N2259K probably damaging Het
Usp24 A G 4: 106,407,035 D1721G possibly damaging Het
Vldlr T A 19: 27,236,274 C120* probably null Het
Vmn2r23 A T 6: 123,704,579 I149L probably benign Het
Vps8 A T 16: 21,434,972 E21V possibly damaging Het
Wdr35 A G 12: 9,012,685 I635V probably damaging Het
Zfp955a T C 17: 33,243,746 D58G probably benign Het
Zkscan5 A G 5: 145,218,593 Q358R probably benign Het
Other mutations in Snx27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Snx27 APN 3 94561972 missense probably damaging 1.00
IGL01061:Snx27 APN 3 94528980 splice site probably benign
IGL01598:Snx27 APN 3 94561843 missense probably damaging 1.00
IGL02276:Snx27 APN 3 94531379 missense probably damaging 1.00
IGL02558:Snx27 APN 3 94502881 missense probably damaging 0.99
IGL02748:Snx27 APN 3 94503565 missense probably benign 0.04
IGL02817:Snx27 APN 3 94503463 missense probably damaging 1.00
IGL02965:Snx27 APN 3 94582426 missense probably damaging 0.99
R0733:Snx27 UTSW 3 94562013 missense probably benign 0.03
R1241:Snx27 UTSW 3 94520233 missense probably benign 0.18
R1882:Snx27 UTSW 3 94519109 missense probably damaging 0.97
R2517:Snx27 UTSW 3 94531234 missense probably damaging 1.00
R3850:Snx27 UTSW 3 94520235 missense probably benign 0.00
R3964:Snx27 UTSW 3 94531306 missense probably damaging 1.00
R4035:Snx27 UTSW 3 94524244 missense probably damaging 0.99
R4172:Snx27 UTSW 3 94503487 missense probably benign 0.00
R4424:Snx27 UTSW 3 94562023 missense probably benign 0.03
R4425:Snx27 UTSW 3 94562023 missense probably benign 0.03
R4548:Snx27 UTSW 3 94526439 intron probably benign
R4820:Snx27 UTSW 3 94520211 missense probably damaging 1.00
R5114:Snx27 UTSW 3 94524244 missense probably damaging 1.00
R5672:Snx27 UTSW 3 94502850 splice site probably null
R5877:Snx27 UTSW 3 94502963 missense probably damaging 1.00
R7138:Snx27 UTSW 3 94528940 missense probably benign 0.04
R7284:Snx27 UTSW 3 94524191 missense probably damaging 0.97
R7593:Snx27 UTSW 3 94502965 missense possibly damaging 0.83
R7827:Snx27 UTSW 3 94519059 missense probably benign 0.11
X0057:Snx27 UTSW 3 94524274 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- CCTGGTTCTAGGTATTAAAGGGTAG -3'
(R):5'- AGGTTATAGTTGCCTGCTGC -3'

Sequencing Primer
(F):5'- TCTAGGTATTAAAGGGTAGATACGC -3'
(R):5'- AGCTGACCTTGAACTTGCAG -3'
Posted On2019-09-13