Incidental Mutation 'R7403:Clca3b'
ID 574326
Institutional Source Beutler Lab
Gene Symbol Clca3b
Ensembl Gene ENSMUSG00000037033
Gene Name chloride channel accessory 3B
Synonyms Clca4
MMRRC Submission 045485-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R7403 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 144528384-144555063 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 144529259 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 805 (L805P)
Ref Sequence ENSEMBL: ENSMUSP00000124581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029929] [ENSMUST00000159989]
AlphaFold E9PUL3
Predicted Effect probably benign
Transcript: ENSMUST00000029929
SMART Domains Protein: ENSMUSP00000029929
Gene: ENSMUSG00000028262

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.5e-21 SMART
FN3 758 857 5.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159989
AA Change: L805P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000124581
Gene: ENSMUSG00000037033
AA Change: L805P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 481 6.22e-19 SMART
FN3 762 861 4.93e0 SMART
low complexity region 880 1025 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl2 G A 10: 83,450,059 (GRCm39) A271V probably benign Het
Brpf3 C T 17: 29,040,330 (GRCm39) T917I probably benign Het
Camta1 G A 4: 151,537,752 (GRCm39) Q143* probably null Het
Cd3e C A 9: 44,913,590 (GRCm39) E48D probably benign Het
Crispld1 A G 1: 17,817,820 (GRCm39) Y241C probably damaging Het
Ddx43 T G 9: 78,321,133 (GRCm39) N380K probably damaging Het
Dtl A T 1: 191,295,285 (GRCm39) V155E probably damaging Het
Eif1ad19 G T 12: 87,740,314 (GRCm39) Q82K probably benign Het
Elp1 A T 4: 56,778,994 (GRCm39) C608S probably damaging Het
Elp2 A G 18: 24,752,542 (GRCm39) H365R probably damaging Het
Fam78a T C 2: 31,959,627 (GRCm39) N161S probably damaging Het
Far2 T C 6: 148,060,475 (GRCm39) I276T possibly damaging Het
Frem3 T C 8: 81,342,774 (GRCm39) L1689P probably damaging Het
Gak T C 5: 108,761,401 (GRCm39) K210R probably benign Het
Gna14 G T 19: 16,576,445 (GRCm39) D151Y Het
Hdhd2 A G 18: 77,042,736 (GRCm39) D55G probably benign Het
Hycc2 A T 1: 58,587,861 (GRCm39) D117E possibly damaging Het
Ifna5 A G 4: 88,754,110 (GRCm39) N117D probably benign Het
Il16 T A 7: 83,319,343 (GRCm39) T383S probably damaging Het
Il36rn T C 2: 24,171,214 (GRCm39) F101L probably damaging Het
Ino80d A G 1: 63,101,378 (GRCm39) V416A possibly damaging Het
Ints6 T C 14: 62,945,104 (GRCm39) R409G possibly damaging Het
Itgb5 G T 16: 33,723,163 (GRCm39) probably null Het
Itprid1 T A 6: 55,953,399 (GRCm39) L905* probably null Het
Kcnq3 T A 15: 65,874,066 (GRCm39) R561W probably damaging Het
Lipo4 C T 19: 33,480,679 (GRCm39) E230K possibly damaging Het
Lrrc7 A T 3: 157,854,311 (GRCm39) L1299* probably null Het
Mcm3ap T C 10: 76,318,657 (GRCm39) probably null Het
Mok A T 12: 110,781,563 (GRCm39) probably null Het
Mylk2 T A 2: 152,759,261 (GRCm39) V344E probably damaging Het
Oacyl T C 18: 65,870,966 (GRCm39) V389A probably benign Het
Oplah T C 15: 76,189,209 (GRCm39) D278G probably benign Het
Or1j8 T C 2: 36,192,342 (GRCm39) F264L probably benign Het
Or8s5 T C 15: 98,238,000 (GRCm39) Y290C probably damaging Het
Padi3 T C 4: 140,527,430 (GRCm39) N124D probably benign Het
Parp3 T C 9: 106,352,052 (GRCm39) S107G probably benign Het
Pcdhb18 G A 18: 37,624,950 (GRCm39) G760D probably benign Het
Plekhh1 G A 12: 79,087,351 (GRCm39) W13* probably null Het
Poglut3 T A 9: 53,301,741 (GRCm39) V131E probably damaging Het
Pou2f1 C T 1: 165,738,955 (GRCm39) A166T unknown Het
Ppp1r10 C T 17: 36,240,326 (GRCm39) P539S probably benign Het
Prdm11 T C 2: 92,817,036 (GRCm39) T310A probably benign Het
Rbm25 A G 12: 83,722,908 (GRCm39) Y777C probably damaging Het
Relt A T 7: 100,500,655 (GRCm39) C72S probably damaging Het
Rhag T A 17: 41,145,549 (GRCm39) I334N probably damaging Het
Rhbdf2 A C 11: 116,491,245 (GRCm39) L630R probably damaging Het
Rnps1 T C 17: 24,644,061 (GRCm39) S274P unknown Het
Rtkn2 A G 10: 67,841,466 (GRCm39) I205V probably benign Het
Ryr1 A T 7: 28,713,292 (GRCm39) V4690E probably benign Het
Secisbp2l T C 2: 125,602,199 (GRCm39) Y387C possibly damaging Het
Sema3d A T 5: 12,547,551 (GRCm39) I158F probably damaging Het
Slc17a1 A G 13: 24,058,690 (GRCm39) N48S probably benign Het
Slc2a1 G A 4: 118,989,752 (GRCm39) G130S probably damaging Het
Slc6a3 T C 13: 73,710,546 (GRCm39) probably null Het
Snx27 A T 3: 94,436,233 (GRCm39) S261T probably damaging Het
Spag17 A T 3: 99,846,691 (GRCm39) I72F possibly damaging Het
Spink6 T G 18: 44,204,564 (GRCm39) L10R unknown Het
Swt1 G A 1: 151,264,444 (GRCm39) T690I probably benign Het
Syne2 G A 12: 75,962,020 (GRCm39) E729K not run Het
Synj2 C T 17: 6,088,005 (GRCm39) T1352M possibly damaging Het
Taar4 G A 10: 23,836,957 (GRCm39) G189D probably damaging Het
Thsd4 T C 9: 59,964,170 (GRCm39) N441D probably damaging Het
Tm9sf2 A G 14: 122,378,640 (GRCm39) D248G probably benign Het
Tmem69 A T 4: 116,410,664 (GRCm39) L102Q probably damaging Het
Tshr A G 12: 91,464,548 (GRCm39) Y98C probably damaging Het
Tspan1 A G 4: 116,020,219 (GRCm39) V230A probably benign Het
Upk3a T C 15: 84,903,709 (GRCm39) V136A possibly damaging Het
Ush2a T A 1: 188,365,924 (GRCm39) N2259K probably damaging Het
Usp24 A G 4: 106,264,232 (GRCm39) D1721G possibly damaging Het
Vldlr T A 19: 27,213,674 (GRCm39) C120* probably null Het
Vmn2r23 A T 6: 123,681,538 (GRCm39) I149L probably benign Het
Vps8 A T 16: 21,253,722 (GRCm39) E21V possibly damaging Het
Wdr35 A G 12: 9,062,685 (GRCm39) I635V probably damaging Het
Zfp955a T C 17: 33,462,720 (GRCm39) D58G probably benign Het
Zkscan5 A G 5: 145,155,403 (GRCm39) Q358R probably benign Het
Other mutations in Clca3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Clca3b APN 3 144,542,393 (GRCm39) missense probably damaging 0.96
IGL00425:Clca3b APN 3 144,542,342 (GRCm39) missense probably benign 0.14
IGL00725:Clca3b APN 3 144,544,923 (GRCm39) missense probably benign 0.01
IGL00898:Clca3b APN 3 144,550,389 (GRCm39) splice site probably benign
IGL00953:Clca3b APN 3 144,552,972 (GRCm39) nonsense probably null
IGL01089:Clca3b APN 3 144,529,283 (GRCm39) missense probably benign
IGL01376:Clca3b APN 3 144,531,812 (GRCm39) missense possibly damaging 0.60
IGL01996:Clca3b APN 3 144,554,924 (GRCm39) missense probably benign 0.04
IGL02022:Clca3b APN 3 144,547,171 (GRCm39) critical splice donor site probably null
IGL02200:Clca3b APN 3 144,547,190 (GRCm39) missense probably damaging 1.00
IGL02314:Clca3b APN 3 144,533,903 (GRCm39) splice site probably benign
IGL02331:Clca3b APN 3 144,547,167 (GRCm39) splice site probably benign
IGL02429:Clca3b APN 3 144,533,896 (GRCm39) missense probably damaging 1.00
IGL02868:Clca3b APN 3 144,533,325 (GRCm39) missense probably damaging 1.00
IGL03095:Clca3b APN 3 144,552,671 (GRCm39) nonsense probably null
IGL03331:Clca3b APN 3 144,533,724 (GRCm39) missense probably benign
R0242:Clca3b UTSW 3 144,547,226 (GRCm39) missense probably benign 0.00
R0242:Clca3b UTSW 3 144,547,226 (GRCm39) missense probably benign 0.00
R0506:Clca3b UTSW 3 144,528,627 (GRCm39) unclassified probably benign
R0524:Clca3b UTSW 3 144,531,082 (GRCm39) missense probably benign
R0637:Clca3b UTSW 3 144,533,701 (GRCm39) missense probably benign 0.03
R1577:Clca3b UTSW 3 144,529,280 (GRCm39) missense probably damaging 1.00
R1641:Clca3b UTSW 3 144,529,274 (GRCm39) missense possibly damaging 0.53
R1680:Clca3b UTSW 3 144,543,585 (GRCm39) missense probably damaging 1.00
R2240:Clca3b UTSW 3 144,531,696 (GRCm39) missense probably benign 0.22
R2248:Clca3b UTSW 3 144,530,980 (GRCm39) missense probably benign 0.01
R2259:Clca3b UTSW 3 144,552,142 (GRCm39) missense possibly damaging 0.80
R2920:Clca3b UTSW 3 144,552,692 (GRCm39) missense probably benign 0.01
R2920:Clca3b UTSW 3 144,543,614 (GRCm39) missense probably benign 0.31
R4355:Clca3b UTSW 3 144,531,219 (GRCm39) splice site probably null
R4691:Clca3b UTSW 3 144,544,853 (GRCm39) missense probably benign 0.02
R4828:Clca3b UTSW 3 144,550,273 (GRCm39) missense probably benign 0.02
R4845:Clca3b UTSW 3 144,531,031 (GRCm39) missense probably benign
R5182:Clca3b UTSW 3 144,533,776 (GRCm39) missense probably damaging 0.99
R5396:Clca3b UTSW 3 144,552,932 (GRCm39) missense probably damaging 0.99
R5429:Clca3b UTSW 3 144,552,220 (GRCm39) missense probably damaging 1.00
R5572:Clca3b UTSW 3 144,533,070 (GRCm39) missense probably damaging 1.00
R5657:Clca3b UTSW 3 144,533,144 (GRCm39) missense probably benign 0.25
R5845:Clca3b UTSW 3 144,531,077 (GRCm39) missense possibly damaging 0.46
R6505:Clca3b UTSW 3 144,531,020 (GRCm39) missense probably benign 0.18
R6677:Clca3b UTSW 3 144,529,145 (GRCm39) missense probably benign 0.13
R6707:Clca3b UTSW 3 144,550,288 (GRCm39) missense probably benign 0.00
R7001:Clca3b UTSW 3 144,533,733 (GRCm39) missense possibly damaging 0.48
R7285:Clca3b UTSW 3 144,543,519 (GRCm39) missense probably benign 0.00
R7323:Clca3b UTSW 3 144,531,681 (GRCm39) missense possibly damaging 0.60
R7324:Clca3b UTSW 3 144,547,181 (GRCm39) missense possibly damaging 0.81
R7334:Clca3b UTSW 3 144,542,417 (GRCm39) nonsense probably null
R7798:Clca3b UTSW 3 144,533,891 (GRCm39) missense probably damaging 1.00
R8008:Clca3b UTSW 3 144,550,370 (GRCm39) missense probably benign 0.44
R8132:Clca3b UTSW 3 144,552,935 (GRCm39) missense probably benign 0.13
R8181:Clca3b UTSW 3 144,544,898 (GRCm39) missense probably benign 0.00
R8305:Clca3b UTSW 3 144,531,698 (GRCm39) missense probably damaging 1.00
R8546:Clca3b UTSW 3 144,533,158 (GRCm39) missense probably damaging 0.99
R8716:Clca3b UTSW 3 144,550,355 (GRCm39) missense probably benign 0.14
R8804:Clca3b UTSW 3 144,544,898 (GRCm39) missense probably benign 0.00
R8966:Clca3b UTSW 3 144,544,872 (GRCm39) missense probably benign 0.27
R9003:Clca3b UTSW 3 144,533,072 (GRCm39) nonsense probably null
R9455:Clca3b UTSW 3 144,529,023 (GRCm39) missense unknown
R9470:Clca3b UTSW 3 144,543,456 (GRCm39) missense probably damaging 1.00
R9658:Clca3b UTSW 3 144,543,575 (GRCm39) missense probably damaging 0.98
R9760:Clca3b UTSW 3 144,552,610 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTGTGCAATGTTGGAGACC -3'
(R):5'- GGACTTATGCTTTTACTCCACATG -3'

Sequencing Primer
(F):5'- TGTGCAATGTTGGAGACCTCAGAG -3'
(R):5'- GTGTACCTTGCTCTAATTTAAAGCAG -3'
Posted On 2019-09-13