Mutagenetix > Incidental Mutations

Incidental Mutation 'R0625:Sec24a'

57433

Institutional Source

Beutler Lab

Gene Symbol

Sec24a

Ensembl Gene

ENSMUSG00000036391

Gene Name

Sec24 related gene family, member A (S. cerevisiae)

Synonyms

9430090N21Rik

MMRRC Submission

038814-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0625 (G1)

Quality Score

169

Status

Not validated

Chromosome

Chromosomal Location

51692264-51763634 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 51729454 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 456 (D456V)

Ref Sequence

ENSEMBL: ENSMUSP00000104720 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038210] [ENSMUST00000064297] [ENSMUST00000109092] [ENSMUST00000109097]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038210
AA Change: D456V

PolyPhen 2 Score 0.493 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000044370
Gene: ENSMUSG00000036391
AA Change: D456V

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	71	84	N/A	INTRINSIC
low complexity region	196	235	N/A	INTRINSIC
low complexity region	396	414	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	423	461	8e-19	PFAM
Pfam:Sec23_trunk	497	735	1.2e-87	PFAM
Pfam:Sec23_BS	740	824	1.1e-23	PFAM
Pfam:Sec23_helical	836	938	5.1e-27	PFAM
Pfam:Gelsolin	960	1035	7.2e-15	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000064297
AA Change: D457V

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000068065
Gene: ENSMUSG00000036391
AA Change: D457V

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	71	84	N/A	INTRINSIC
low complexity region	196	235	N/A	INTRINSIC
low complexity region	396	414	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	424	462	3.5e-18	PFAM
Pfam:Sec23_trunk	498	589	1.3e-29	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000109092
AA Change: D456V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000104720
Gene: ENSMUSG00000036391
AA Change: D456V

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	71	84	N/A	INTRINSIC
low complexity region	196	235	N/A	INTRINSIC
low complexity region	396	414	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	423	461	3.9e-19	PFAM
Pfam:Sec23_trunk	497	588	1.6e-30	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109097
AA Change: D457V

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000104725
Gene: ENSMUSG00000036391
AA Change: D457V

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	71	84	N/A	INTRINSIC
low complexity region	196	235	N/A	INTRINSIC
low complexity region	396	414	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	425	462	2.4e-16	PFAM
Pfam:Sec23_trunk	498	736	7.8e-87	PFAM
Pfam:Sec23_BS	741	825	1.1e-22	PFAM
Pfam:Sec23_helical	838	938	6.9e-28	PFAM
Pfam:Gelsolin	961	1036	9.3e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147255

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.5%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of proteins that are homologous to yeast Sec24. This protein is a component of coat protein II (COPII)-coated vesicles that mediate protein transport from the endoplasmic reticulum. COPII acts in the cytoplasm to promote the transport of secretory, plasma membrane, and vacuolar proteins from the endoplasmic reticulum to the golgi complex. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased circulating cholesterol level, decreased circulating LDL cholesterol level, and abnormal liver physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930550C14Rik	T	C	9: 53,408,065	S2P	probably benign	Het
Abca16	A	C	7: 120,435,893	T301P	probably damaging	Het
Acer2	A	G	4: 86,887,162	D121G	possibly damaging	Het
Adgrd1	T	C	5: 129,171,931		probably null	Het
Arhgap11a	T	C	2: 113,841,711	I249V	probably benign	Het
Arhgap22	A	G	14: 33,366,714	E219G	probably benign	Het
C2cd4b	T	A	9: 67,759,751	S10T	probably benign	Het
Cnot6	A	T	11: 49,683,171	I224N	probably damaging	Het
Ctrc	T	C	4: 141,841,518	T125A	probably damaging	Het
Cxxc5	T	G	18: 35,858,589	S14R	unknown	Het
Cyp4f37	T	G	17: 32,634,678	F445L	probably damaging	Het
Dcbld1	T	G	10: 52,312,850	I186S	probably benign	Het
Dmxl2	T	C	9: 54,382,702	T2510A	probably benign	Het
Dnah3	A	G	7: 120,071,887	I591T	possibly damaging	Het
Dock5	A	T	14: 67,841,163	I204N	probably benign	Het
Dysf	G	A	6: 84,111,987		probably null	Het
Erich5	A	G	15: 34,471,369	E248G	probably damaging	Het
Fam160a1	A	G	3: 85,730,500	V164A	possibly damaging	Het
Foxm1	A	G	6: 128,373,871	S712G	probably damaging	Het
Frmpd1	A	G	4: 45,284,055	T959A	probably benign	Het
Gfra4	C	T	2: 131,040,256	V277I	probably null	Het
Hacd4	T	C	4: 88,435,010	I82V	probably benign	Het
Itih2	C	T	2: 10,123,414	V159I	possibly damaging	Het
Itpr2	T	A	6: 146,166,651	M2410L	probably benign	Het
March11	A	G	15: 26,311,043	I202V	probably damaging	Het
March3	A	G	18: 56,811,830		probably null	Het
Med12l	G	A	3: 59,247,437	E1135K	probably damaging	Het
Mib2	C	T	4: 155,659,460	G42S	probably damaging	Het
Mlx	T	C	11: 101,087,782	L78P	possibly damaging	Het
Muc5b	T	C	7: 141,846,427	C473R	unknown	Het
N4bp2l1	T	A	5: 150,576,745	R66*	probably null	Het
Nes	A	G	3: 87,977,172	T913A	possibly damaging	Het
Oas1a	T	C	5: 120,899,259	E235G	probably damaging	Het
Olfr1104	T	A	2: 87,021,620	H308L	probably benign	Het
Olfr477	T	C	7: 107,991,189	S275P	probably damaging	Het
Olfr905	T	C	9: 38,473,208	S154P	possibly damaging	Het
Parn	C	T	16: 13,640,294	V286I	probably benign	Het
Paxip1	G	A	5: 27,765,942	Q470*	probably null	Het
Phc2	C	G	4: 128,723,710	H510D	possibly damaging	Het
Pla2g4f	T	A	2: 120,305,041	D384V	probably damaging	Het
Plpbp	A	T	8: 27,045,131	N68I	probably damaging	Het
Podxl2	G	A	6: 88,849,955	A123V	possibly damaging	Het
Pole	A	T	5: 110,325,550	T1737S	possibly damaging	Het
Ppp3cc	T	C	14: 70,225,027	E396G	probably damaging	Het
Pramel7	T	A	2: 87,491,008	I228F	probably benign	Het
Prl7d1	A	T	13: 27,710,140	C149S	probably benign	Het
Qtrt1	G	T	9: 21,418,288	M217I	probably benign	Het
Shox2	T	G	3: 66,981,544		probably null	Het
Skint2	T	A	4: 112,624,086	S49T	probably damaging	Het
Smarca5	A	G	8: 80,720,686		probably null	Het
Sorcs2	T	A	5: 36,024,572	D1068V	possibly damaging	Het
Tmem114	T	C	16: 8,412,102		probably null	Het
Ttc7b	T	A	12: 100,355,046	M24L	probably benign	Het
Ttll3	A	G	6: 113,408,903		probably null	Het
Usp7	C	T	16: 8,704,982	D102N	probably benign	Het

Other mutations in Sec24a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00571:Sec24a	APN	11	51736504	nonsense	probably null
IGL00973:Sec24a	APN	11	51729577	critical splice acceptor site	probably null
IGL01364:Sec24a	APN	11	51713529	critical splice donor site	probably null
IGL01476:Sec24a	APN	11	51708956	missense	possibly damaging	0.88
IGL01725:Sec24a	APN	11	51723578	splice site	probably null
IGL02069:Sec24a	APN	11	51733934	splice site	probably benign
IGL02230:Sec24a	APN	11	51709034	missense	possibly damaging	0.88
IGL02617:Sec24a	APN	11	51712187	critical splice donor site	probably null
IGL02655:Sec24a	APN	11	51734655	missense	probably benign	0.43
IGL02756:Sec24a	APN	11	51696733	missense	probably benign	0.02
IGL03396:Sec24a	APN	11	51708967	missense	probably benign	0.17
R0153:Sec24a	UTSW	11	51700826	missense	probably benign	0.08
R0506:Sec24a	UTSW	11	51743795	missense	probably benign	0.03
R1084:Sec24a	UTSW	11	51713581	missense	probably damaging	1.00
R1166:Sec24a	UTSW	11	51733467	missense	possibly damaging	0.72
R1376:Sec24a	UTSW	11	51700913	splice site	probably benign
R1487:Sec24a	UTSW	11	51731886	missense	possibly damaging	0.92
R1541:Sec24a	UTSW	11	51743796	missense	probably benign	0.41
R1582:Sec24a	UTSW	11	51708967	missense	probably benign	0.17
R1643:Sec24a	UTSW	11	51704385	missense	probably benign	0.03
R1672:Sec24a	UTSW	11	51743948	nonsense	probably null
R1681:Sec24a	UTSW	11	51695189	missense	probably damaging	0.98
R1756:Sec24a	UTSW	11	51733763	splice site	probably benign
R1992:Sec24a	UTSW	11	51736363	missense	probably benign	0.00
R2159:Sec24a	UTSW	11	51712350	missense	probably damaging	1.00
R2177:Sec24a	UTSW	11	51704401	missense	probably benign	0.00
R2188:Sec24a	UTSW	11	51723584	missense	probably damaging	0.99
R2271:Sec24a	UTSW	11	51716450	missense	possibly damaging	0.91
R3414:Sec24a	UTSW	11	51729458	missense	probably damaging	1.00
R4349:Sec24a	UTSW	11	51715149	missense	probably benign	0.03
R4396:Sec24a	UTSW	11	51715164	missense	possibly damaging	0.86
R4629:Sec24a	UTSW	11	51721813	critical splice donor site	probably null
R5061:Sec24a	UTSW	11	51713532	splice site	probably null
R5577:Sec24a	UTSW	11	51734621	missense	probably benign	0.06
R5717:Sec24a	UTSW	11	51707210	missense	probably benign
R5915:Sec24a	UTSW	11	51756137	missense	probably benign	0.11
R6175:Sec24a	UTSW	11	51731891	missense	probably damaging	1.00
R6341:Sec24a	UTSW	11	51717776	missense	probably damaging	0.99
R6461:Sec24a	UTSW	11	51713546	missense	possibly damaging	0.76
R6610:Sec24a	UTSW	11	51696656	missense	probably benign
R6632:Sec24a	UTSW	11	51713649	nonsense	probably null
R6907:Sec24a	UTSW	11	51712276	missense	probably damaging	1.00
R6969:Sec24a	UTSW	11	51700816	missense	probably benign	0.35
R7132:Sec24a	UTSW	11	51715136	nonsense	probably null
R7274:Sec24a	UTSW	11	51707255	missense	probably damaging	1.00
R7475:Sec24a	UTSW	11	51713552	missense	probably damaging	1.00
R7699:Sec24a	UTSW	11	51712257	missense	probably damaging	1.00
R7700:Sec24a	UTSW	11	51712257	missense	probably damaging	1.00
R7935:Sec24a	UTSW	11	51721922	missense	probably benign	0.25
R8042:Sec24a	UTSW	11	51704317	missense	probably benign
R8345:Sec24a	UTSW	11	51743778	missense	probably benign	0.00
X0025:Sec24a	UTSW	11	51729547	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ccagccccCCTAGATGGCtttttat -3'
(R):5'- CTACCCACTTGTGGTGTTGGGAAAT -3'

Sequencing Primer
(F):5'- aaatcctctatcccttcccca -3'
(R):5'- acttattgctgccctcctg -3'

Posted On

2013-07-11