Mutagenetix > Incidental Mutation

Incidental Mutation 'R7403:Gak'

574337

Institutional Source

Beutler Lab

Gene Symbol

Gak

Ensembl Gene

ENSMUSG00000062234

Gene Name

cyclin G associated kinase

Synonyms

D130045N16Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7403 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

108569411-108629755 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 108613535 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 210 (K210R)

Ref Sequence

ENSEMBL: ENSMUSP00000036705 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046603] [ENSMUST00000135225] [ENSMUST00000145467] [ENSMUST00000199048]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000046603
AA Change: K210R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000036705
Gene: ENSMUSG00000062234
AA Change: K210R

Domain	Start	End	E-Value	Type
low complexity region	11	22	N/A	INTRINSIC
Pfam:Pkinase	40	313	1.6e-49	PFAM
Pfam:Pkinase_Tyr	40	313	3e-30	PFAM
PTEN_C2	568	707	1.43e-44	SMART
low complexity region	819	833	N/A	INTRINSIC
low complexity region	932	945	N/A	INTRINSIC
low complexity region	1084	1092	N/A	INTRINSIC
low complexity region	1094	1110	N/A	INTRINSIC
DnaJ	1240	1301	2.3e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000135225

SMART Domains

Protein: ENSMUSP00000118008
Gene: ENSMUSG00000062234

Domain	Start	End	E-Value	Type
low complexity region	11	22	N/A	INTRINSIC
Pfam:Pkinase	40	128	7.9e-11	PFAM
Pfam:Pkinase_Tyr	40	128	1.2e-6	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000145467

SMART Domains

Protein: ENSMUSP00000118713
Gene: ENSMUSG00000062234

Domain	Start	End	E-Value	Type
low complexity region	11	22	N/A	INTRINSIC
Pfam:Pkinase	40	128	7.9e-11	PFAM
Pfam:Pkinase_Tyr	40	128	1.2e-6	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000199048

SMART Domains

Protein: ENSMUSP00000142931
Gene: ENSMUSG00000062234

Domain	Start	End	E-Value	Type
low complexity region	11	22	N/A	INTRINSIC
PDB:4O38\|B	23	69	3e-10	PDB
SCOP:d1koba_	41	69	3e-5	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In all eukaryotes, the cell cycle is governed by cyclin-dependent protein kinases (CDKs), whose activities are regulated by cyclins and CDK inhibitors in a diverse array of mechanisms that involve the control of phosphorylation and dephosphorylation of Ser, Thr or Tyr residues. Cyclins are molecules that possess a consensus domain called the 'cyclin box.' In mammalian cells, 9 cyclin species have been identified, and they are referred to as cyclins A through I. Cyclin G is a direct transcriptional target of the p53 tumor suppressor gene product and thus functions downstream of p53. GAK is an association partner of cyclin G and CDK5. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a deletion of the kinase domain display neonatal lethality with abnormal lung alveolar morphology and development. Mice homozygous for a knock-out allele exhibit lethality during early development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Appl2	G	A	10: 83,614,195	A271V	probably benign	Het
Brpf3	C	T	17: 28,821,356	T917I	probably benign	Het
Camta1	G	A	4: 151,453,295	Q143*	probably null	Het
Ccdc129	T	A	6: 55,976,414	L905*	probably null	Het
Cd3e	C	A	9: 45,002,292	E48D	probably benign	Het
Clca3b	A	G	3: 144,823,498	L805P	probably benign	Het
Crispld1	A	G	1: 17,747,596	Y241C	probably damaging	Het
Ddx43	T	G	9: 78,413,851	N380K	probably damaging	Het
Dtl	A	T	1: 191,563,173	V155E	probably damaging	Het
Elp2	A	G	18: 24,619,485	H365R	probably damaging	Het
Fam126b	A	T	1: 58,548,702	D117E	possibly damaging	Het
Fam78a	T	C	2: 32,069,615	N161S	probably damaging	Het
Far2	T	C	6: 148,158,977	I276T	possibly damaging	Het
Frem3	T	C	8: 80,616,145	L1689P	probably damaging	Het
Gm21319	G	T	12: 87,773,544	Q82K	probably benign	Het
Gna14	G	T	19: 16,599,081	D151Y		Het
Hdhd2	A	G	18: 76,955,040	D55G	probably benign	Het
Ifna5	A	G	4: 88,835,873	N117D	probably benign	Het
Ikbkap	A	T	4: 56,778,994	C608S	probably damaging	Het
Il16	T	A	7: 83,670,135	T383S	probably damaging	Het
Il1f5	T	C	2: 24,281,202	F101L	probably damaging	Het
Ino80d	A	G	1: 63,062,219	V416A	possibly damaging	Het
Ints6	T	C	14: 62,707,655	R409G	possibly damaging	Het
Itgb5	G	T	16: 33,902,793		probably null	Het
Kcnq3	T	A	15: 66,002,217	R561W	probably damaging	Het
Kdelc2	T	A	9: 53,390,441	V131E	probably damaging	Het
Lipo4	C	T	19: 33,503,279	E230K	possibly damaging	Het
Lrrc7	A	T	3: 158,148,674	L1299*	probably null	Het
Mcm3ap	T	C	10: 76,482,823		probably null	Het
Mok	A	T	12: 110,815,129		probably null	Het
Mylk2	T	A	2: 152,917,341	V344E	probably damaging	Het
Oacyl	T	C	18: 65,737,895	V389A	probably benign	Het
Olfr284	T	C	15: 98,340,119	Y290C	probably damaging	Het
Olfr335-ps	T	C	2: 36,302,330	F264L	probably benign	Het
Oplah	T	C	15: 76,305,009	D278G	probably benign	Het
Padi3	T	C	4: 140,800,119	N124D	probably benign	Het
Parp3	T	C	9: 106,474,853	S107G	probably benign	Het
Pcdhb18	G	A	18: 37,491,897	G760D	probably benign	Het
Plekhh1	G	A	12: 79,040,577	W13*	probably null	Het
Pou2f1	C	T	1: 165,911,386	A166T	unknown	Het
Ppp1r10	C	T	17: 35,929,434	P539S	probably benign	Het
Prdm11	T	C	2: 92,986,691	T310A	probably benign	Het
Rbm25	A	G	12: 83,676,134	Y777C	probably damaging	Het
Relt	A	T	7: 100,851,448	C72S	probably damaging	Het
Rhag	T	A	17: 40,834,658	I334N	probably damaging	Het
Rhbdf2	A	C	11: 116,600,419	L630R	probably damaging	Het
Rnps1	T	C	17: 24,425,087	S274P	unknown	Het
Rtkn2	A	G	10: 68,005,636	I205V	probably benign	Het
Ryr1	A	T	7: 29,013,867	V4690E	probably benign	Het
Secisbp2l	T	C	2: 125,760,279	Y387C	possibly damaging	Het
Sema3d	A	T	5: 12,497,584	I158F	probably damaging	Het
Slc17a1	A	G	13: 23,874,707	N48S	probably benign	Het
Slc2a1	G	A	4: 119,132,555	G130S	probably damaging	Het
Slc6a3	T	C	13: 73,562,427		probably null	Het
Snx27	A	T	3: 94,528,926	S261T	probably damaging	Het
Spag17	A	T	3: 99,939,375	I72F	possibly damaging	Het
Spink6	T	G	18: 44,071,497	L10R	unknown	Het
Swt1	G	A	1: 151,388,693	T690I	probably benign	Het
Syne2	G	A	12: 75,915,246	E729K	not run	Het
Synj2	C	T	17: 6,037,730	T1352M	possibly damaging	Het
Taar4	G	A	10: 23,961,059	G189D	probably damaging	Het
Thsd4	T	C	9: 60,056,887	N441D	probably damaging	Het
Tm9sf2	A	G	14: 122,141,228	D248G	probably benign	Het
Tmem69	A	T	4: 116,553,467	L102Q	probably damaging	Het
Tshr	A	G	12: 91,497,774	Y98C	probably damaging	Het
Tspan1	A	G	4: 116,163,022	V230A	probably benign	Het
Upk3a	T	C	15: 85,019,508	V136A	possibly damaging	Het
Ush2a	T	A	1: 188,633,727	N2259K	probably damaging	Het
Usp24	A	G	4: 106,407,035	D1721G	possibly damaging	Het
Vldlr	T	A	19: 27,236,274	C120*	probably null	Het
Vmn2r23	A	T	6: 123,704,579	I149L	probably benign	Het
Vps8	A	T	16: 21,434,972	E21V	possibly damaging	Het
Wdr35	A	G	12: 9,012,685	I635V	probably damaging	Het
Zfp955a	T	C	17: 33,243,746	D58G	probably benign	Het
Zkscan5	A	G	5: 145,218,593	Q358R	probably benign	Het

Other mutations in Gak

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00694:Gak	APN	5	108613634	makesense	probably null
IGL00768:Gak	APN	5	108576654	missense	probably benign
IGL01128:Gak	APN	5	108592370	missense	probably damaging	0.97
IGL01557:Gak	APN	5	108584337	missense	probably damaging	1.00
IGL02559:Gak	APN	5	108584232	missense	probably null	0.07
PIT4449001:Gak	UTSW	5	108580925	missense	probably benign	0.00
R0030:Gak	UTSW	5	108613547	nonsense	probably null
R1403:Gak	UTSW	5	108591145	missense	probably damaging	1.00
R1403:Gak	UTSW	5	108591145	missense	probably damaging	1.00
R1530:Gak	UTSW	5	108624193	missense	probably damaging	0.97
R1646:Gak	UTSW	5	108602854	missense	probably damaging	1.00
R1699:Gak	UTSW	5	108604377	nonsense	probably null
R1702:Gak	UTSW	5	108606376	splice site	probably null
R1732:Gak	UTSW	5	108576582	missense	probably benign	0.28
R1738:Gak	UTSW	5	108616976	missense	probably damaging	1.00
R1772:Gak	UTSW	5	108606892	missense	probably damaging	1.00
R1792:Gak	UTSW	5	108585531	nonsense	probably null
R2068:Gak	UTSW	5	108570225	missense	probably benign
R2137:Gak	UTSW	5	108606877	splice site	probably null
R2138:Gak	UTSW	5	108606877	splice site	probably null
R2139:Gak	UTSW	5	108606877	splice site	probably null
R2904:Gak	UTSW	5	108624214	missense	possibly damaging	0.70
R3080:Gak	UTSW	5	108613602	missense	possibly damaging	0.90
R3773:Gak	UTSW	5	108582672	missense	probably benign	0.00
R4523:Gak	UTSW	5	108576566	missense	probably benign	0.22
R4665:Gak	UTSW	5	108582960	missense	probably benign
R4703:Gak	UTSW	5	108569877	missense	probably damaging	0.99
R4890:Gak	UTSW	5	108580876	unclassified	probably benign
R4951:Gak	UTSW	5	108582718	missense	probably benign
R4971:Gak	UTSW	5	108596806	missense	probably damaging	1.00
R5328:Gak	UTSW	5	108617001	missense	possibly damaging	0.94
R5436:Gak	UTSW	5	108592352	missense	possibly damaging	0.94
R5496:Gak	UTSW	5	108576617	missense	probably benign	0.00
R6207:Gak	UTSW	5	108625029	critical splice donor site	probably null
R6359:Gak	UTSW	5	108571900	missense	probably damaging	1.00
R6468:Gak	UTSW	5	108623336	nonsense	probably null
R6682:Gak	UTSW	5	108598876	missense	probably damaging	1.00
R6915:Gak	UTSW	5	108602950	missense	probably benign	0.20
R7458:Gak	UTSW	5	108583074	missense	probably benign	0.00
R7522:Gak	UTSW	5	108591199	missense	possibly damaging	0.95
R7650:Gak	UTSW	5	108584295	missense	probably benign	0.00
R7737:Gak	UTSW	5	108617008	missense	probably benign	0.15
R8437:Gak	UTSW	5	108609406	missense	probably benign	0.30
R8739:Gak	UTSW	5	108591738	missense	possibly damaging	0.65
R8954:Gak	UTSW	5	108629652	start gained	probably benign
X0064:Gak	UTSW	5	108613533	nonsense	probably null
Z1177:Gak	UTSW	5	108585352	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AGCAAGTGTTCTATCAGCCCTC -3'
(R):5'- CCTGATAAGGAACTGACCATGAC -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- GGAACTGACCATGACTAATATTCCTG -3'

Posted On

2019-09-13