Incidental Mutation 'R7403:Vmn2r23'
ID574340
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Namevomeronasal 2, receptor 23
SynonymsEG435916
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7403 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location123702821-123742291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123704579 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 149 (I149L)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
Predicted Effect probably benign
Transcript: ENSMUST00000172391
AA Change: I149L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: I149L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl2 G A 10: 83,614,195 A271V probably benign Het
Brpf3 C T 17: 28,821,356 T917I probably benign Het
Camta1 G A 4: 151,453,295 Q143* probably null Het
Ccdc129 T A 6: 55,976,414 L905* probably null Het
Cd3e C A 9: 45,002,292 E48D probably benign Het
Clca3b A G 3: 144,823,498 L805P probably benign Het
Crispld1 A G 1: 17,747,596 Y241C probably damaging Het
Ddx43 T G 9: 78,413,851 N380K probably damaging Het
Dtl A T 1: 191,563,173 V155E probably damaging Het
Elp2 A G 18: 24,619,485 H365R probably damaging Het
Fam126b A T 1: 58,548,702 D117E possibly damaging Het
Fam78a T C 2: 32,069,615 N161S probably damaging Het
Far2 T C 6: 148,158,977 I276T possibly damaging Het
Frem3 T C 8: 80,616,145 L1689P probably damaging Het
Gak T C 5: 108,613,535 K210R probably benign Het
Gm21319 G T 12: 87,773,544 Q82K probably benign Het
Gna14 G T 19: 16,599,081 D151Y Het
Hdhd2 A G 18: 76,955,040 D55G probably benign Het
Ifna5 A G 4: 88,835,873 N117D probably benign Het
Ikbkap A T 4: 56,778,994 C608S probably damaging Het
Il16 T A 7: 83,670,135 T383S probably damaging Het
Il1f5 T C 2: 24,281,202 F101L probably damaging Het
Ino80d A G 1: 63,062,219 V416A possibly damaging Het
Ints6 T C 14: 62,707,655 R409G possibly damaging Het
Itgb5 G T 16: 33,902,793 probably null Het
Kcnq3 T A 15: 66,002,217 R561W probably damaging Het
Kdelc2 T A 9: 53,390,441 V131E probably damaging Het
Lipo4 C T 19: 33,503,279 E230K possibly damaging Het
Lrrc7 A T 3: 158,148,674 L1299* probably null Het
Mcm3ap T C 10: 76,482,823 probably null Het
Mok A T 12: 110,815,129 probably null Het
Mylk2 T A 2: 152,917,341 V344E probably damaging Het
Oacyl T C 18: 65,737,895 V389A probably benign Het
Olfr284 T C 15: 98,340,119 Y290C probably damaging Het
Olfr335-ps T C 2: 36,302,330 F264L probably benign Het
Oplah T C 15: 76,305,009 D278G probably benign Het
Padi3 T C 4: 140,800,119 N124D probably benign Het
Parp3 T C 9: 106,474,853 S107G probably benign Het
Pcdhb18 G A 18: 37,491,897 G760D probably benign Het
Plekhh1 G A 12: 79,040,577 W13* probably null Het
Pou2f1 C T 1: 165,911,386 A166T unknown Het
Ppp1r10 C T 17: 35,929,434 P539S probably benign Het
Prdm11 T C 2: 92,986,691 T310A probably benign Het
Rbm25 A G 12: 83,676,134 Y777C probably damaging Het
Relt A T 7: 100,851,448 C72S probably damaging Het
Rhag T A 17: 40,834,658 I334N probably damaging Het
Rhbdf2 A C 11: 116,600,419 L630R probably damaging Het
Rnps1 T C 17: 24,425,087 S274P unknown Het
Rtkn2 A G 10: 68,005,636 I205V probably benign Het
Ryr1 A T 7: 29,013,867 V4690E probably benign Het
Secisbp2l T C 2: 125,760,279 Y387C possibly damaging Het
Sema3d A T 5: 12,497,584 I158F probably damaging Het
Slc17a1 A G 13: 23,874,707 N48S probably benign Het
Slc2a1 G A 4: 119,132,555 G130S probably damaging Het
Slc6a3 T C 13: 73,562,427 probably null Het
Snx27 A T 3: 94,528,926 S261T probably damaging Het
Spag17 A T 3: 99,939,375 I72F possibly damaging Het
Spink6 T G 18: 44,071,497 L10R unknown Het
Swt1 G A 1: 151,388,693 T690I probably benign Het
Syne2 G A 12: 75,915,246 E729K not run Het
Synj2 C T 17: 6,037,730 T1352M possibly damaging Het
Taar4 G A 10: 23,961,059 G189D probably damaging Het
Thsd4 T C 9: 60,056,887 N441D probably damaging Het
Tm9sf2 A G 14: 122,141,228 D248G probably benign Het
Tmem69 A T 4: 116,553,467 L102Q probably damaging Het
Tshr A G 12: 91,497,774 Y98C probably damaging Het
Tspan1 A G 4: 116,163,022 V230A probably benign Het
Upk3a T C 15: 85,019,508 V136A possibly damaging Het
Ush2a T A 1: 188,633,727 N2259K probably damaging Het
Usp24 A G 4: 106,407,035 D1721G possibly damaging Het
Vldlr T A 19: 27,236,274 C120* probably null Het
Vps8 A T 16: 21,434,972 E21V possibly damaging Het
Wdr35 A G 12: 9,012,685 I635V probably damaging Het
Zfp955a T C 17: 33,243,746 D58G probably benign Het
Zkscan5 A G 5: 145,218,593 Q358R probably benign Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123729725 missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123729596 missense probably benign
IGL01073:Vmn2r23 APN 6 123712800 missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123704424 missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123704407 missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123741886 missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123741860 missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123741744 missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123741836 missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123704478 missense probably benign
IGL02831:Vmn2r23 APN 6 123704385 missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123704396 missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123741619 missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123741782 missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123704374 missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123729626 missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123729721 missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123742135 missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123742004 missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123713270 nonsense probably null
R1629:Vmn2r23 UTSW 6 123713427 missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123729690 missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123702915 missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123713010 missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123741499 missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123704425 missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123742188 nonsense probably null
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123713170 missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123741389 missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123729738 missense probably benign
R4506:Vmn2r23 UTSW 6 123702925 missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123741730 missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123741826 missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123733349 missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123713002 missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123733273 missense probably benign
R5761:Vmn2r23 UTSW 6 123712759 missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123733393 missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123712942 missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123741895 missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123704400 missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123712902 missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123713425 missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123733273 missense probably benign
R6925:Vmn2r23 UTSW 6 123704553 missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123713022 missense probably benign
R7215:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123741581 missense probably damaging 0.97
R8015:Vmn2r23 UTSW 6 123704541 missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123741353 missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123704640 missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123741656 missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123713472 missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123703032 missense
RF018:Vmn2r23 UTSW 6 123713116 missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123713161 missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123742108 missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123729725 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCAGCACATGTTGGCAATGG -3'
(R):5'- GCAAAGGACATTTTCTTGGGAG -3'

Sequencing Primer
(F):5'- CAGCACATGTTGGCAATGGTTTTTG -3'
(R):5'- CATTTTCTTGGGAGTGGTAAGAATAC -3'
Posted On2019-09-13