Mutagenetix > Incidental Mutation

Incidental Mutation 'R7403:Slc6a3'

574364

Institutional Source

Beutler Lab

Gene Symbol

Slc6a3

Ensembl Gene

ENSMUSG00000021609

Gene Name

solute carrier family 6 (neurotransmitter transporter, dopamine), member 3

Synonyms

Dat1, DAT

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7403 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

73536747-73578672 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 73562427 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000022100 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022100]

AlphaFold

Q61327

Predicted Effect

probably null
Transcript: ENSMUST00000022100

SMART Domains

Protein: ENSMUSP00000022100
Gene: ENSMUSG00000021609

Domain	Start	End	E-Value	Type
Pfam:SNF	60	582	8.1e-237	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dopamine transporter which is a member of the sodium- and chloride-dependent neurotransmitter transporter family. The 3' UTR of this gene contains a 40 bp tandem repeat, referred to as a variable number tandem repeat or VNTR, which can be present in 3 to 11 copies. Variation in the number of repeats is associated with idiopathic epilepsy, attention-deficit hyperactivity disorder, dependence on alcohol and cocaine, susceptibility to Parkinson disease and protection against nicotine dependence.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit dwarfism, hyperactivity (especially in a novel environment), 5-fold higher extracellular dopamine levels, impaired spatial cognitive function, anterior pituitary hypoplasia, and failure to lactate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Appl2	G	A	10: 83,614,195	A271V	probably benign	Het
Brpf3	C	T	17: 28,821,356	T917I	probably benign	Het
Camta1	G	A	4: 151,453,295	Q143*	probably null	Het
Ccdc129	T	A	6: 55,976,414	L905*	probably null	Het
Cd3e	C	A	9: 45,002,292	E48D	probably benign	Het
Clca3b	A	G	3: 144,823,498	L805P	probably benign	Het
Crispld1	A	G	1: 17,747,596	Y241C	probably damaging	Het
Ddx43	T	G	9: 78,413,851	N380K	probably damaging	Het
Dtl	A	T	1: 191,563,173	V155E	probably damaging	Het
Elp2	A	G	18: 24,619,485	H365R	probably damaging	Het
Fam126b	A	T	1: 58,548,702	D117E	possibly damaging	Het
Fam78a	T	C	2: 32,069,615	N161S	probably damaging	Het
Far2	T	C	6: 148,158,977	I276T	possibly damaging	Het
Frem3	T	C	8: 80,616,145	L1689P	probably damaging	Het
Gak	T	C	5: 108,613,535	K210R	probably benign	Het
Gm21319	G	T	12: 87,773,544	Q82K	probably benign	Het
Gna14	G	T	19: 16,599,081	D151Y		Het
Hdhd2	A	G	18: 76,955,040	D55G	probably benign	Het
Ifna5	A	G	4: 88,835,873	N117D	probably benign	Het
Ikbkap	A	T	4: 56,778,994	C608S	probably damaging	Het
Il16	T	A	7: 83,670,135	T383S	probably damaging	Het
Il1f5	T	C	2: 24,281,202	F101L	probably damaging	Het
Ino80d	A	G	1: 63,062,219	V416A	possibly damaging	Het
Ints6	T	C	14: 62,707,655	R409G	possibly damaging	Het
Itgb5	G	T	16: 33,902,793		probably null	Het
Kcnq3	T	A	15: 66,002,217	R561W	probably damaging	Het
Kdelc2	T	A	9: 53,390,441	V131E	probably damaging	Het
Lipo4	C	T	19: 33,503,279	E230K	possibly damaging	Het
Lrrc7	A	T	3: 158,148,674	L1299*	probably null	Het
Mcm3ap	T	C	10: 76,482,823		probably null	Het
Mok	A	T	12: 110,815,129		probably null	Het
Mylk2	T	A	2: 152,917,341	V344E	probably damaging	Het
Oacyl	T	C	18: 65,737,895	V389A	probably benign	Het
Olfr284	T	C	15: 98,340,119	Y290C	probably damaging	Het
Olfr335-ps	T	C	2: 36,302,330	F264L	probably benign	Het
Oplah	T	C	15: 76,305,009	D278G	probably benign	Het
Padi3	T	C	4: 140,800,119	N124D	probably benign	Het
Parp3	T	C	9: 106,474,853	S107G	probably benign	Het
Pcdhb18	G	A	18: 37,491,897	G760D	probably benign	Het
Plekhh1	G	A	12: 79,040,577	W13*	probably null	Het
Pou2f1	C	T	1: 165,911,386	A166T	unknown	Het
Ppp1r10	C	T	17: 35,929,434	P539S	probably benign	Het
Prdm11	T	C	2: 92,986,691	T310A	probably benign	Het
Rbm25	A	G	12: 83,676,134	Y777C	probably damaging	Het
Relt	A	T	7: 100,851,448	C72S	probably damaging	Het
Rhag	T	A	17: 40,834,658	I334N	probably damaging	Het
Rhbdf2	A	C	11: 116,600,419	L630R	probably damaging	Het
Rnps1	T	C	17: 24,425,087	S274P	unknown	Het
Rtkn2	A	G	10: 68,005,636	I205V	probably benign	Het
Ryr1	A	T	7: 29,013,867	V4690E	probably benign	Het
Secisbp2l	T	C	2: 125,760,279	Y387C	possibly damaging	Het
Sema3d	A	T	5: 12,497,584	I158F	probably damaging	Het
Slc17a1	A	G	13: 23,874,707	N48S	probably benign	Het
Slc2a1	G	A	4: 119,132,555	G130S	probably damaging	Het
Snx27	A	T	3: 94,528,926	S261T	probably damaging	Het
Spag17	A	T	3: 99,939,375	I72F	possibly damaging	Het
Spink6	T	G	18: 44,071,497	L10R	unknown	Het
Swt1	G	A	1: 151,388,693	T690I	probably benign	Het
Syne2	G	A	12: 75,915,246	E729K	not run	Het
Synj2	C	T	17: 6,037,730	T1352M	possibly damaging	Het
Taar4	G	A	10: 23,961,059	G189D	probably damaging	Het
Thsd4	T	C	9: 60,056,887	N441D	probably damaging	Het
Tm9sf2	A	G	14: 122,141,228	D248G	probably benign	Het
Tmem69	A	T	4: 116,553,467	L102Q	probably damaging	Het
Tshr	A	G	12: 91,497,774	Y98C	probably damaging	Het
Tspan1	A	G	4: 116,163,022	V230A	probably benign	Het
Upk3a	T	C	15: 85,019,508	V136A	possibly damaging	Het
Ush2a	T	A	1: 188,633,727	N2259K	probably damaging	Het
Usp24	A	G	4: 106,407,035	D1721G	possibly damaging	Het
Vldlr	T	A	19: 27,236,274	C120*	probably null	Het
Vmn2r23	A	T	6: 123,704,579	I149L	probably benign	Het
Vps8	A	T	16: 21,434,972	E21V	possibly damaging	Het
Wdr35	A	G	12: 9,012,685	I635V	probably damaging	Het
Zfp955a	T	C	17: 33,243,746	D58G	probably benign	Het
Zkscan5	A	G	5: 145,218,593	Q358R	probably benign	Het

Other mutations in Slc6a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00773:Slc6a3	APN	13	73544741	missense	probably damaging	1.00
IGL01524:Slc6a3	APN	13	73538549	missense	probably benign	0.01
IGL02015:Slc6a3	APN	13	73544714	missense	possibly damaging	0.60
IGL03008:Slc6a3	APN	13	73558285	critical splice donor site	probably null
IGL03029:Slc6a3	APN	13	73538697	missense	probably damaging	1.00
IGL03064:Slc6a3	APN	13	73571466	missense	probably damaging	0.99
IGL03272:Slc6a3	APN	13	73540929	missense	probably damaging	0.98
IGL03294:Slc6a3	APN	13	73557181	critical splice donor site	probably null
IGL03345:Slc6a3	APN	13	73571514	missense	probably benign
IGL03410:Slc6a3	APN	13	73538657	missense	probably benign	0.03
disney	UTSW	13	73544884	missense	probably benign
dopey	UTSW	13	73560959	missense	probably damaging	1.00
Dopey2	UTSW	13	73544817	missense	probably damaging	1.00
Stiff	UTSW	13	73557050	missense	possibly damaging	0.85
PIT4382001:Slc6a3	UTSW	13	73571523	missense	probably benign	0.35
R0024:Slc6a3	UTSW	13	73540837	splice site	probably benign
R0125:Slc6a3	UTSW	13	73569979	splice site	probably benign
R0180:Slc6a3	UTSW	13	73562336	missense	probably damaging	1.00
R0288:Slc6a3	UTSW	13	73560928	missense	probably damaging	1.00
R0322:Slc6a3	UTSW	13	73560926	missense	possibly damaging	0.61
R0349:Slc6a3	UTSW	13	73567557	missense	probably damaging	1.00
R0411:Slc6a3	UTSW	13	73557050	missense	possibly damaging	0.85
R0594:Slc6a3	UTSW	13	73538642	missense	probably damaging	0.99
R0680:Slc6a3	UTSW	13	73538727	missense	probably damaging	1.00
R1099:Slc6a3	UTSW	13	73567641	missense	probably benign	0.21
R1109:Slc6a3	UTSW	13	73557080	missense	probably benign	0.00
R1791:Slc6a3	UTSW	13	73566292	missense	possibly damaging	0.82
R3916:Slc6a3	UTSW	13	73562308	missense	probably benign	0.00
R4279:Slc6a3	UTSW	13	73544834	missense	possibly damaging	0.90
R4368:Slc6a3	UTSW	13	73560912	nonsense	probably null
R4520:Slc6a3	UTSW	13	73540856	missense	possibly damaging	0.95
R4666:Slc6a3	UTSW	13	73538581	missense	possibly damaging	0.47
R4675:Slc6a3	UTSW	13	73544817	missense	probably damaging	1.00
R4716:Slc6a3	UTSW	13	73557076	missense	probably benign	0.04
R5243:Slc6a3	UTSW	13	73571451	missense	possibly damaging	0.61
R5355:Slc6a3	UTSW	13	73560959	missense	probably damaging	1.00
R5681:Slc6a3	UTSW	13	73538735	missense	probably damaging	0.99
R5737:Slc6a3	UTSW	13	73544804	missense	probably damaging	0.99
R6142:Slc6a3	UTSW	13	73544783	missense	probably benign	0.00
R6471:Slc6a3	UTSW	13	73544884	missense	probably benign
R7168:Slc6a3	UTSW	13	73571472	missense	probably benign	0.00
R8282:Slc6a3	UTSW	13	73557081	missense	probably benign	0.01
R8359:Slc6a3	UTSW	13	73544883	missense	probably benign
R8446:Slc6a3	UTSW	13	73571555	missense	possibly damaging	0.67
R8979:Slc6a3	UTSW	13	73567601	missense	probably benign	0.20
R9051:Slc6a3	UTSW	13	73569912	nonsense	probably null
R9377:Slc6a3	UTSW	13	73544847	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- TAACAGTTGGCATTCCCAGAG -3'
(R):5'- TCAGGTGAGCCCAGCATAGAAG -3'

Sequencing Primer
(F):5'- GCCGCTGCTTAACTGGTGTC -3'
(R):5'- TGAGCCCAGCATAGAAGATATG -3'

Posted On

2019-09-13