Incidental Mutation 'R7403:Kcnq3'
ID574367
Institutional Source Beutler Lab
Gene Symbol Kcnq3
Ensembl Gene ENSMUSG00000056258
Gene Namepotassium voltage-gated channel, subfamily Q, member 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R7403 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location65986387-66286642 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66002217 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 561 (R561W)
Ref Sequence ENSEMBL: ENSMUSP00000063380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070256]
Predicted Effect probably damaging
Transcript: ENSMUST00000070256
AA Change: R561W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063380
Gene: ENSMUSG00000056258
AA Change: R561W

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
Pfam:Ion_trans 122 364 9.9e-31 PFAM
Pfam:Ion_trans_2 268 357 3.4e-14 PFAM
Pfam:KCNQ_channel 448 658 1.4e-89 PFAM
Pfam:KCNQC3-Ank-G_bd 771 867 3.8e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the regulation of neuronal excitability. The encoded protein forms an M-channel by associating with the products of the related KCNQ2 or KCNQ5 genes, which both encode integral membrane proteins. M-channel currents are inhibited by M1 muscarinic acetylcholine receptors and are activated by retigabine, a novel anti-convulsant drug. Defects in this gene are a cause of benign familial neonatal convulsions type 2 (BFNC2), also known as epilepsy, benign neonatal type 2 (EBN2). Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal apamin-insensitive afterhyperpolarization currents in granule cells, but not pyramidal cells, of the hippocampus. Mice homozygous for a knock-in allele exhibit spontaneous seizures and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl2 G A 10: 83,614,195 A271V probably benign Het
Brpf3 C T 17: 28,821,356 T917I probably benign Het
Camta1 G A 4: 151,453,295 Q143* probably null Het
Ccdc129 T A 6: 55,976,414 L905* probably null Het
Cd3e C A 9: 45,002,292 E48D probably benign Het
Clca3b A G 3: 144,823,498 L805P probably benign Het
Crispld1 A G 1: 17,747,596 Y241C probably damaging Het
Ddx43 T G 9: 78,413,851 N380K probably damaging Het
Dtl A T 1: 191,563,173 V155E probably damaging Het
Elp2 A G 18: 24,619,485 H365R probably damaging Het
Fam126b A T 1: 58,548,702 D117E possibly damaging Het
Fam78a T C 2: 32,069,615 N161S probably damaging Het
Far2 T C 6: 148,158,977 I276T possibly damaging Het
Frem3 T C 8: 80,616,145 L1689P probably damaging Het
Gak T C 5: 108,613,535 K210R probably benign Het
Gm21319 G T 12: 87,773,544 Q82K probably benign Het
Gna14 G T 19: 16,599,081 D151Y Het
Hdhd2 A G 18: 76,955,040 D55G probably benign Het
Ifna5 A G 4: 88,835,873 N117D probably benign Het
Ikbkap A T 4: 56,778,994 C608S probably damaging Het
Il16 T A 7: 83,670,135 T383S probably damaging Het
Il1f5 T C 2: 24,281,202 F101L probably damaging Het
Ino80d A G 1: 63,062,219 V416A possibly damaging Het
Ints6 T C 14: 62,707,655 R409G possibly damaging Het
Itgb5 G T 16: 33,902,793 probably null Het
Kdelc2 T A 9: 53,390,441 V131E probably damaging Het
Lipo4 C T 19: 33,503,279 E230K possibly damaging Het
Lrrc7 A T 3: 158,148,674 L1299* probably null Het
Mcm3ap T C 10: 76,482,823 probably null Het
Mok A T 12: 110,815,129 probably null Het
Mylk2 T A 2: 152,917,341 V344E probably damaging Het
Oacyl T C 18: 65,737,895 V389A probably benign Het
Olfr284 T C 15: 98,340,119 Y290C probably damaging Het
Olfr335-ps T C 2: 36,302,330 F264L probably benign Het
Oplah T C 15: 76,305,009 D278G probably benign Het
Padi3 T C 4: 140,800,119 N124D probably benign Het
Parp3 T C 9: 106,474,853 S107G probably benign Het
Pcdhb18 G A 18: 37,491,897 G760D probably benign Het
Plekhh1 G A 12: 79,040,577 W13* probably null Het
Pou2f1 C T 1: 165,911,386 A166T unknown Het
Ppp1r10 C T 17: 35,929,434 P539S probably benign Het
Prdm11 T C 2: 92,986,691 T310A probably benign Het
Rbm25 A G 12: 83,676,134 Y777C probably damaging Het
Relt A T 7: 100,851,448 C72S probably damaging Het
Rhag T A 17: 40,834,658 I334N probably damaging Het
Rhbdf2 A C 11: 116,600,419 L630R probably damaging Het
Rnps1 T C 17: 24,425,087 S274P unknown Het
Rtkn2 A G 10: 68,005,636 I205V probably benign Het
Ryr1 A T 7: 29,013,867 V4690E probably benign Het
Secisbp2l T C 2: 125,760,279 Y387C possibly damaging Het
Sema3d A T 5: 12,497,584 I158F probably damaging Het
Slc17a1 A G 13: 23,874,707 N48S probably benign Het
Slc2a1 G A 4: 119,132,555 G130S probably damaging Het
Slc6a3 T C 13: 73,562,427 probably null Het
Snx27 A T 3: 94,528,926 S261T probably damaging Het
Spag17 A T 3: 99,939,375 I72F possibly damaging Het
Spink6 T G 18: 44,071,497 L10R unknown Het
Swt1 G A 1: 151,388,693 T690I probably benign Het
Syne2 G A 12: 75,915,246 E729K not run Het
Synj2 C T 17: 6,037,730 T1352M possibly damaging Het
Taar4 G A 10: 23,961,059 G189D probably damaging Het
Thsd4 T C 9: 60,056,887 N441D probably damaging Het
Tm9sf2 A G 14: 122,141,228 D248G probably benign Het
Tmem69 A T 4: 116,553,467 L102Q probably damaging Het
Tshr A G 12: 91,497,774 Y98C probably damaging Het
Tspan1 A G 4: 116,163,022 V230A probably benign Het
Upk3a T C 15: 85,019,508 V136A possibly damaging Het
Ush2a T A 1: 188,633,727 N2259K probably damaging Het
Usp24 A G 4: 106,407,035 D1721G possibly damaging Het
Vldlr T A 19: 27,236,274 C120* probably null Het
Vmn2r23 A T 6: 123,704,579 I149L probably benign Het
Vps8 A T 16: 21,434,972 E21V possibly damaging Het
Wdr35 A G 12: 9,012,685 I635V probably damaging Het
Zfp955a T C 17: 33,243,746 D58G probably benign Het
Zkscan5 A G 5: 145,218,593 Q358R probably benign Het
Other mutations in Kcnq3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Kcnq3 APN 15 65995271 missense probably damaging 1.00
IGL00808:Kcnq3 APN 15 65995754 missense possibly damaging 0.49
IGL00969:Kcnq3 APN 15 66004726 missense probably damaging 1.00
IGL01121:Kcnq3 APN 15 66005977 splice site probably benign
IGL01996:Kcnq3 APN 15 66023696 missense probably damaging 0.98
IGL02153:Kcnq3 APN 15 66025191 missense probably damaging 0.96
IGL02950:Kcnq3 APN 15 66020293 missense probably benign 0.12
IGL02963:Kcnq3 APN 15 66285826 splice site probably benign
IGL03102:Kcnq3 APN 15 66028788 missense probably damaging 1.00
IGL03050:Kcnq3 UTSW 15 66025178 missense possibly damaging 0.52
R0345:Kcnq3 UTSW 15 66020305 missense possibly damaging 0.55
R0388:Kcnq3 UTSW 15 66000038 missense probably benign 0.00
R0730:Kcnq3 UTSW 15 65995608 missense probably benign
R1173:Kcnq3 UTSW 15 66000042 missense probably benign 0.01
R1610:Kcnq3 UTSW 15 66025260 missense probably damaging 1.00
R1678:Kcnq3 UTSW 15 66031432 missense probably damaging 1.00
R1714:Kcnq3 UTSW 15 66000063 missense probably benign 0.21
R1755:Kcnq3 UTSW 15 65995421 missense probably damaging 1.00
R1768:Kcnq3 UTSW 15 66005906 missense probably damaging 0.98
R1873:Kcnq3 UTSW 15 66002255 missense probably benign 0.16
R1925:Kcnq3 UTSW 15 66004809 missense possibly damaging 0.75
R1970:Kcnq3 UTSW 15 66028623 critical splice donor site probably null
R2140:Kcnq3 UTSW 15 66005978 splice site probably benign
R2141:Kcnq3 UTSW 15 65995851 missense probably benign 0.21
R2149:Kcnq3 UTSW 15 66023729 missense probably damaging 1.00
R2212:Kcnq3 UTSW 15 66020293 missense probably benign
R2272:Kcnq3 UTSW 15 66028680 missense probably damaging 1.00
R2566:Kcnq3 UTSW 15 66031427 missense probably damaging 1.00
R2909:Kcnq3 UTSW 15 66025236 missense possibly damaging 0.87
R3703:Kcnq3 UTSW 15 66021739 critical splice donor site probably null
R3704:Kcnq3 UTSW 15 66021739 critical splice donor site probably null
R3899:Kcnq3 UTSW 15 66030523 missense probably benign 0.01
R4096:Kcnq3 UTSW 15 66285815 intron probably null
R4421:Kcnq3 UTSW 15 65995511 missense probably benign 0.01
R4504:Kcnq3 UTSW 15 65995342 nonsense probably null
R4505:Kcnq3 UTSW 15 65995342 nonsense probably null
R4571:Kcnq3 UTSW 15 66030612 missense probably damaging 1.00
R4577:Kcnq3 UTSW 15 66286214 missense unknown
R4900:Kcnq3 UTSW 15 65995410 missense probably damaging 1.00
R4981:Kcnq3 UTSW 15 66031405 missense possibly damaging 0.84
R5015:Kcnq3 UTSW 15 66004763 missense probably damaging 1.00
R5049:Kcnq3 UTSW 15 66285897 missense probably benign 0.17
R5245:Kcnq3 UTSW 15 66031435 missense possibly damaging 0.89
R5334:Kcnq3 UTSW 15 66025224 missense probably damaging 1.00
R5528:Kcnq3 UTSW 15 66025178 missense probably damaging 0.97
R5532:Kcnq3 UTSW 15 65997773 nonsense probably null
R5630:Kcnq3 UTSW 15 66025122 missense probably damaging 1.00
R5639:Kcnq3 UTSW 15 65997750 missense probably damaging 0.96
R5936:Kcnq3 UTSW 15 66000110 missense probably damaging 1.00
R6306:Kcnq3 UTSW 15 66004794 missense probably benign 0.40
R6576:Kcnq3 UTSW 15 66025178 missense possibly damaging 0.52
R7006:Kcnq3 UTSW 15 66020316 nonsense probably null
R8140:Kcnq3 UTSW 15 65995541 missense probably damaging 1.00
RF045:Kcnq3 UTSW 15 66286184 small deletion probably benign
X0060:Kcnq3 UTSW 15 66031386 missense probably damaging 1.00
Z1177:Kcnq3 UTSW 15 65995452 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CACAGTGTTAAATGTGTCCTCCTG -3'
(R):5'- AAGGCCAGCATTCTGCCATC -3'

Sequencing Primer
(F):5'- AAATGTGTCCTCCTGTTTGTGAAG -3'
(R):5'- CTGGAGTTTGCTGTACAGGC -3'
Posted On2019-09-13