Incidental Mutation 'R7404:Dnah7c'
ID574387
Institutional Source Beutler Lab
Gene Symbol Dnah7c
Ensembl Gene ENSMUSG00000101337
Gene Namedynein, axonemal, heavy chain 7C
SynonymsDnahc7c
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R7404 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location46425592-46807476 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46666063 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2412 (V2412A)
Ref Sequence ENSEMBL: ENSMUSP00000140430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000189749]
Predicted Effect possibly damaging
Transcript: ENSMUST00000189749
AA Change: V2412A

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: V2412A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 37 48 N/A INTRINSIC
coiled coil region 714 746 N/A INTRINSIC
Pfam:DHC_N2 754 1167 2.2e-138 PFAM
AAA 1320 1459 4e-3 SMART
Blast:AAA 1601 1829 4e-87 BLAST
AAA 1968 2116 8.7e-4 SMART
Pfam:AAA_8 2303 2574 6.2e-73 PFAM
Pfam:MT 2586 2935 5.4e-52 PFAM
Pfam:AAA_9 2953 3183 7.4e-63 PFAM
Pfam:Dynein_heavy 3312 4021 1.3e-250 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (92/93)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
Ablim3 C T 18: 61,822,028 A297T probably damaging Het
Adprhl1 T A 8: 13,225,118 S547C probably damaging Het
Ankrd63 G C 2: 118,703,312 R43G unknown Het
Asah2 T C 19: 32,057,854 T24A probably benign Het
Asb17 G A 3: 153,844,810 probably null Het
Atp8b5 C T 4: 43,342,640 T437I probably benign Het
Bbs2 T C 8: 94,082,364 D311G probably damaging Het
Birc6 C T 17: 74,639,794 T2851I possibly damaging Het
Cchcr1 T C 17: 35,524,796 W266R probably benign Het
Col14a1 C A 15: 55,388,628 S560* probably null Het
Crocc G A 4: 141,026,186 T1317M possibly damaging Het
Cxxc1 T A 18: 74,219,207 V334E possibly damaging Het
Cyp3a25 T A 5: 145,986,825 D336V probably damaging Het
D430042O09Rik A T 7: 125,865,262 N1267I probably damaging Het
Dapk1 A G 13: 60,719,641 T221A probably benign Het
Dnah11 G T 12: 118,104,808 T1605K probably benign Het
Ect2l T A 10: 18,159,781 D524V probably damaging Het
Ehbp1l1 T C 19: 5,720,844 E223G possibly damaging Het
Ephb2 A T 4: 136,771,213 M185K probably damaging Het
Fcer1a T C 1: 173,221,516 K243E probably damaging Het
Fcgbp T A 7: 28,101,507 I1326N probably damaging Het
Fgfr1 T C 8: 25,555,550 V45A probably benign Het
Filip1 T A 9: 79,820,098 E413V possibly damaging Het
Frs3 T C 17: 47,702,726 probably null Het
Fstl4 A G 11: 53,134,071 T257A probably benign Het
Gm15922 T C 7: 3,739,345 Y61C probably damaging Het
Golga5 A T 12: 102,484,519 K477M probably damaging Het
Gpr171 A T 3: 59,098,201 I51K probably damaging Het
H1f0 T A 15: 79,028,880 Y53* probably null Het
Hephl1 A G 9: 15,069,751 V795A possibly damaging Het
Hmcn1 A T 1: 150,720,759 D1775E probably benign Het
Hs3st2 A G 7: 121,500,945 D338G possibly damaging Het
Hsd3b6 T A 3: 98,806,218 Y255F probably benign Het
Hspa9 T C 18: 34,943,276 N328D possibly damaging Het
Hvcn1 T A 5: 122,237,685 I100N probably damaging Het
Ifi207 C T 1: 173,728,928 S748N possibly damaging Het
Kcnma1 G T 14: 24,002,834 T180K unknown Het
Kctd16 A G 18: 40,258,773 D138G probably damaging Het
Kifc3 A G 8: 95,103,464 Y605H probably benign Het
Kmt2d T A 15: 98,845,495 Q3928L unknown Het
Lamb2 C T 9: 108,487,583 R1179C probably damaging Het
Layn T A 9: 51,057,370 I358F possibly damaging Het
Lrig1 G A 6: 94,626,471 T232M probably damaging Het
Lrp1 T C 10: 127,582,708 T38A Het
Map3k14 A G 11: 103,239,092 V333A probably benign Het
Med13 T C 11: 86,286,446 D1608G possibly damaging Het
Mrps31 T G 8: 22,421,413 S224A probably benign Het
Msh6 G T 17: 87,975,120 Het
Ncapd3 A G 9: 27,067,019 D838G probably benign Het
Nlrp1a C A 11: 71,097,093 E1184* probably null Het
Npat T A 9: 53,554,933 probably null Het
Nup210 A T 6: 91,073,245 I414N probably benign Het
Olfr1097 A C 2: 86,890,873 L101V probably benign Het
Olfr1346 T C 7: 6,474,164 L18P probably damaging Het
Olfr1484 T A 19: 13,585,388 I28N possibly damaging Het
Olfr187 T C 16: 59,036,240 T166A possibly damaging Het
Olfr378 A T 11: 73,425,593 L130H probably damaging Het
Olfr666 A T 7: 104,892,974 V218E possibly damaging Het
Olfr876 A T 9: 37,803,961 T17S possibly damaging Het
Otud7b G C 3: 96,136,625 probably null Het
Phf11d A C 14: 59,359,493 W86G probably benign Het
Pik3c2b T A 1: 133,090,706 S964T probably damaging Het
Plod3 G A 5: 136,995,047 V687I probably benign Het
Poglut1 T G 16: 38,537,922 Y208S possibly damaging Het
Pou1f1 T A 16: 65,533,863 L253H probably damaging Het
Pou2f1 C T 1: 165,911,386 A166T unknown Het
Rhbdl3 C T 11: 80,346,833 S297L probably damaging Het
Rxra A T 2: 27,741,854 N179I probably damaging Het
Ryr2 C T 13: 11,735,620 E1922K probably damaging Het
Scube1 T C 15: 83,615,010 Y668C probably damaging Het
Sec16b A G 1: 157,531,357 Y120C probably damaging Het
Sec61b G T 4: 47,483,047 K92N probably damaging Het
Slc13a3 T C 2: 165,434,064 N254S possibly damaging Het
Slc17a7 T A 7: 45,172,930 Y397N probably benign Het
Slc25a3 A G 10: 91,117,040 V333A possibly damaging Het
Slc7a8 A T 14: 54,726,826 V390E probably damaging Het
Sorbs2 G A 8: 45,759,196 probably null Het
Srgap1 T C 10: 121,785,745 N948D probably benign Het
Tacc2 A T 7: 130,623,336 T584S probably benign Het
Tec A T 5: 72,763,618 D471E probably damaging Het
Tecpr2 C T 12: 110,931,604 A430V probably benign Het
Tmcc2 A T 1: 132,361,021 D309E probably damaging Het
Tmem82 G A 4: 141,617,431 A67V possibly damaging Het
Ttc23l T C 15: 10,551,577 Q21R probably damaging Het
Ttc37 T A 13: 76,148,747 Y1074* probably null Het
Ubl3 A G 5: 148,511,954 F26L probably damaging Het
Upf2 A G 2: 6,040,203 E1088G unknown Het
Usp9y T A Y: 1,341,780 I1362F probably benign Het
Wnk4 T A 11: 101,268,492 probably null Het
Wrn C G 8: 33,248,966 W1278S probably benign Het
Zfc3h1 T A 10: 115,415,248 V1248D probably damaging Het
Zfp12 T A 5: 143,240,344 V56D probably damaging Het
Other mutations in Dnah7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Dnah7c APN 1 46807289 missense possibly damaging 0.72
IGL02958:Dnah7c APN 1 46657111 missense probably damaging 1.00
IGL03035:Dnah7c APN 1 46524117 missense probably benign 0.37
IGL03161:Dnah7c APN 1 46467296 missense probably benign 0.20
IGL03178:Dnah7c APN 1 46467365 missense probably benign
IGL03052:Dnah7c UTSW 1 46632149 missense probably damaging 1.00
R0751:Dnah7c UTSW 1 46465905 missense probably benign
R1029:Dnah7c UTSW 1 46612721 missense probably damaging 1.00
R3104:Dnah7c UTSW 1 46798279 missense probably damaging 0.97
R3977:Dnah7c UTSW 1 46628911 missense possibly damaging 0.75
R4003:Dnah7c UTSW 1 46681817 missense probably damaging 1.00
R4133:Dnah7c UTSW 1 46665990 missense probably benign 0.01
R4303:Dnah7c UTSW 1 46748578 missense probably damaging 1.00
R4329:Dnah7c UTSW 1 46649281 missense probably benign 0.33
R4434:Dnah7c UTSW 1 46666282 missense probably damaging 1.00
R4457:Dnah7c UTSW 1 46740621 missense probably damaging 1.00
R4470:Dnah7c UTSW 1 46748635 missense possibly damaging 0.56
R4507:Dnah7c UTSW 1 46766611 missense probably damaging 1.00
R4527:Dnah7c UTSW 1 46532931 missense probably benign 0.34
R4571:Dnah7c UTSW 1 46533216 missense probably damaging 0.99
R4589:Dnah7c UTSW 1 46514583 nonsense probably null
R4731:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4732:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4733:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4747:Dnah7c UTSW 1 46533168 missense probably damaging 1.00
R4845:Dnah7c UTSW 1 46793532 missense probably damaging 1.00
R4873:Dnah7c UTSW 1 46688925 missense probably benign
R4875:Dnah7c UTSW 1 46688925 missense probably benign
R4916:Dnah7c UTSW 1 46595008 missense probably damaging 1.00
R5241:Dnah7c UTSW 1 46530500 missense probably benign
R5279:Dnah7c UTSW 1 46519269 missense probably benign 0.14
R5327:Dnah7c UTSW 1 46665568 missense probably benign 0.05
R5546:Dnah7c UTSW 1 46666317 missense probably damaging 1.00
R5605:Dnah7c UTSW 1 46798235 missense possibly damaging 0.84
R5637:Dnah7c UTSW 1 46760361 splice site probably null
R5639:Dnah7c UTSW 1 46739668 missense probably benign
R5663:Dnah7c UTSW 1 46535148 missense probably damaging 1.00
R5718:Dnah7c UTSW 1 46748666 missense possibly damaging 0.47
R5759:Dnah7c UTSW 1 46615367 missense probably damaging 1.00
R5771:Dnah7c UTSW 1 46639665 missense probably benign 0.00
R5784:Dnah7c UTSW 1 46524068 missense possibly damaging 0.80
R5800:Dnah7c UTSW 1 46647015 missense probably benign 0.01
R5933:Dnah7c UTSW 1 46519215 missense probably damaging 1.00
R5948:Dnah7c UTSW 1 46672497 missense probably benign 0.21
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6487:Dnah7c UTSW 1 46769124 missense probably damaging 1.00
R6536:Dnah7c UTSW 1 46658290 missense probably benign 0.00
R6614:Dnah7c UTSW 1 46649340 missense probably benign
R6614:Dnah7c UTSW 1 46649351 missense probably benign
R6615:Dnah7c UTSW 1 46515439 missense probably benign 0.01
R6615:Dnah7c UTSW 1 46649340 missense probably benign
R6615:Dnah7c UTSW 1 46649351 missense probably benign
R6649:Dnah7c UTSW 1 46649340 missense probably benign
R6649:Dnah7c UTSW 1 46649351 missense probably benign
R6650:Dnah7c UTSW 1 46649340 missense probably benign
R6650:Dnah7c UTSW 1 46649351 missense probably benign
R6651:Dnah7c UTSW 1 46649340 missense probably benign
R6651:Dnah7c UTSW 1 46649351 missense probably benign
R6653:Dnah7c UTSW 1 46649340 missense probably benign
R6653:Dnah7c UTSW 1 46649351 missense probably benign
R6714:Dnah7c UTSW 1 46740806 missense probably damaging 0.99
R6729:Dnah7c UTSW 1 46672521 missense possibly damaging 0.46
R6760:Dnah7c UTSW 1 46649340 missense probably benign
R6760:Dnah7c UTSW 1 46649351 missense probably benign
R6763:Dnah7c UTSW 1 46628890 missense possibly damaging 0.60
R6866:Dnah7c UTSW 1 46657243 missense probably damaging 1.00
R6880:Dnah7c UTSW 1 46527671 missense probably damaging 0.97
R6988:Dnah7c UTSW 1 46666213 missense possibly damaging 0.68
R6995:Dnah7c UTSW 1 46455813 missense probably benign 0.07
R7007:Dnah7c UTSW 1 46532750 missense probably benign 0.04
R7086:Dnah7c UTSW 1 46750125 missense probably benign 0.00
R7128:Dnah7c UTSW 1 46527485 missense probably benign
R7131:Dnah7c UTSW 1 46681772 missense probably benign 0.00
R7135:Dnah7c UTSW 1 46533208 missense probably damaging 1.00
R7171:Dnah7c UTSW 1 46680738 missense probably damaging 0.99
R7176:Dnah7c UTSW 1 46430809 missense probably benign 0.00
R7221:Dnah7c UTSW 1 46455777 missense possibly damaging 0.87
R7310:Dnah7c UTSW 1 46596967 missense possibly damaging 0.94
R7319:Dnah7c UTSW 1 46780775 missense probably benign 0.31
R7319:Dnah7c UTSW 1 46784448 missense possibly damaging 0.95
R7452:Dnah7c UTSW 1 46647036 missense possibly damaging 0.91
R7515:Dnah7c UTSW 1 46457290 missense probably benign
R7534:Dnah7c UTSW 1 46770067 missense probably damaging 0.98
R7542:Dnah7c UTSW 1 46784498 missense probably benign 0.00
R7605:Dnah7c UTSW 1 46632310 missense probably damaging 1.00
R7643:Dnah7c UTSW 1 46602813 missense probably benign
R7770:Dnah7c UTSW 1 46626300 splice site probably null
R7884:Dnah7c UTSW 1 46791769 missense probably benign 0.23
R7899:Dnah7c UTSW 1 46514701 missense probably benign 0.00
R8025:Dnah7c UTSW 1 46457296 missense probably benign 0.01
R8057:Dnah7c UTSW 1 46688952 missense possibly damaging 0.52
R8191:Dnah7c UTSW 1 46607458 missense possibly damaging 0.56
R8255:Dnah7c UTSW 1 46659429 missense probably damaging 1.00
R8428:Dnah7c UTSW 1 46672376 missense probably damaging 1.00
R8441:Dnah7c UTSW 1 46533238 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46467302 missense probably benign 0.00
Z1176:Dnah7c UTSW 1 46615281 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46639665 missense probably benign
Z1176:Dnah7c UTSW 1 46646992 critical splice acceptor site probably null
Z1176:Dnah7c UTSW 1 46760316 missense possibly damaging 0.95
Z1177:Dnah7c UTSW 1 46654103 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CAGACTTGCTGCACACATGG -3'
(R):5'- AATCCGAAATGCGTCTCCAATGG -3'

Sequencing Primer
(F):5'- GCACACATGGCTGATTATTCAC -3'
(R):5'- GAAATGCGTCTCCAATGGGACTC -3'
Posted On2019-09-13