Incidental Mutation 'R0625:Ppp3cc'
ID57440
Institutional Source Beutler Lab
Gene Symbol Ppp3cc
Ensembl Gene ENSMUSG00000022092
Gene Nameprotein phosphatase 3, catalytic subunit, gamma isoform
SynonymsCalnc, PP2BA gamma
MMRRC Submission 038814-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0625 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location70217865-70289471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70225027 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 396 (E396G)
Ref Sequence ENSEMBL: ENSMUSP00000153725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078434] [ENSMUST00000228911]
Predicted Effect probably damaging
Transcript: ENSMUST00000078434
AA Change: E387G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000077532
Gene: ENSMUSG00000022092
AA Change: E387G

DomainStartEndE-ValueType
PP2Ac 52 343 4e-151 SMART
low complexity region 413 433 N/A INTRINSIC
low complexity region 492 500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228265
Predicted Effect probably damaging
Transcript: ENSMUST00000228911
AA Change: E396G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcineurin is a calcium-dependent, calmodulin-stimulated protein phosphatase involved in the downstream regulation of dopaminergic signal transduction. Calcineurin is composed of a regulatory subunit and a catalytic subunit. The protein encoded by this gene represents one of the regulatory subunits that has been found for calcineurin. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to reduced hyperactivated sperm motility and midpiece rigidity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T C 9: 53,408,065 S2P probably benign Het
Abca16 A C 7: 120,435,893 T301P probably damaging Het
Acer2 A G 4: 86,887,162 D121G possibly damaging Het
Adgrd1 T C 5: 129,171,931 probably null Het
Arhgap11a T C 2: 113,841,711 I249V probably benign Het
Arhgap22 A G 14: 33,366,714 E219G probably benign Het
C2cd4b T A 9: 67,759,751 S10T probably benign Het
Cnot6 A T 11: 49,683,171 I224N probably damaging Het
Ctrc T C 4: 141,841,518 T125A probably damaging Het
Cxxc5 T G 18: 35,858,589 S14R unknown Het
Cyp4f37 T G 17: 32,634,678 F445L probably damaging Het
Dcbld1 T G 10: 52,312,850 I186S probably benign Het
Dmxl2 T C 9: 54,382,702 T2510A probably benign Het
Dnah3 A G 7: 120,071,887 I591T possibly damaging Het
Dock5 A T 14: 67,841,163 I204N probably benign Het
Dysf G A 6: 84,111,987 probably null Het
Erich5 A G 15: 34,471,369 E248G probably damaging Het
Fam160a1 A G 3: 85,730,500 V164A possibly damaging Het
Foxm1 A G 6: 128,373,871 S712G probably damaging Het
Frmpd1 A G 4: 45,284,055 T959A probably benign Het
Gfra4 C T 2: 131,040,256 V277I probably null Het
Hacd4 T C 4: 88,435,010 I82V probably benign Het
Itih2 C T 2: 10,123,414 V159I possibly damaging Het
Itpr2 T A 6: 146,166,651 M2410L probably benign Het
March11 A G 15: 26,311,043 I202V probably damaging Het
March3 A G 18: 56,811,830 probably null Het
Med12l G A 3: 59,247,437 E1135K probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlx T C 11: 101,087,782 L78P possibly damaging Het
Muc5b T C 7: 141,846,427 C473R unknown Het
N4bp2l1 T A 5: 150,576,745 R66* probably null Het
Nes A G 3: 87,977,172 T913A possibly damaging Het
Oas1a T C 5: 120,899,259 E235G probably damaging Het
Olfr1104 T A 2: 87,021,620 H308L probably benign Het
Olfr477 T C 7: 107,991,189 S275P probably damaging Het
Olfr905 T C 9: 38,473,208 S154P possibly damaging Het
Parn C T 16: 13,640,294 V286I probably benign Het
Paxip1 G A 5: 27,765,942 Q470* probably null Het
Phc2 C G 4: 128,723,710 H510D possibly damaging Het
Pla2g4f T A 2: 120,305,041 D384V probably damaging Het
Plpbp A T 8: 27,045,131 N68I probably damaging Het
Podxl2 G A 6: 88,849,955 A123V possibly damaging Het
Pole A T 5: 110,325,550 T1737S possibly damaging Het
Pramel7 T A 2: 87,491,008 I228F probably benign Het
Prl7d1 A T 13: 27,710,140 C149S probably benign Het
Qtrt1 G T 9: 21,418,288 M217I probably benign Het
Sec24a T A 11: 51,729,454 D456V probably damaging Het
Shox2 T G 3: 66,981,544 probably null Het
Skint2 T A 4: 112,624,086 S49T probably damaging Het
Smarca5 A G 8: 80,720,686 probably null Het
Sorcs2 T A 5: 36,024,572 D1068V possibly damaging Het
Tmem114 T C 16: 8,412,102 probably null Het
Ttc7b T A 12: 100,355,046 M24L probably benign Het
Ttll3 A G 6: 113,408,903 probably null Het
Usp7 C T 16: 8,704,982 D102N probably benign Het
Other mutations in Ppp3cc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Ppp3cc APN 14 70218252 missense probably damaging 0.99
IGL02182:Ppp3cc APN 14 70225024 missense probably benign 0.21
IGL02272:Ppp3cc APN 14 70236489 missense probably damaging 1.00
IGL03207:Ppp3cc APN 14 70247582 missense probably damaging 1.00
IGL03394:Ppp3cc APN 14 70225028 nonsense probably null
tomap UTSW 14 70240948 missense probably damaging 1.00
R0111:Ppp3cc UTSW 14 70256359 critical splice donor site probably null
R1368:Ppp3cc UTSW 14 70245862 missense probably damaging 1.00
R1484:Ppp3cc UTSW 14 70240948 missense probably damaging 1.00
R4757:Ppp3cc UTSW 14 70218186 missense possibly damaging 0.94
R6198:Ppp3cc UTSW 14 70247611 missense probably benign 0.20
R7042:Ppp3cc UTSW 14 70225019 missense probably benign 0.14
R7209:Ppp3cc UTSW 14 70267498 missense probably benign 0.00
R7305:Ppp3cc UTSW 14 70240803 missense probably benign
R7406:Ppp3cc UTSW 14 70245938 missense possibly damaging 0.80
R7509:Ppp3cc UTSW 14 70266682 missense probably damaging 1.00
R7623:Ppp3cc UTSW 14 70240945 missense probably benign 0.37
R7814:Ppp3cc UTSW 14 70225015 missense possibly damaging 0.68
RF002:Ppp3cc UTSW 14 70267339 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- ACTCAACCAGAAGACTTGCAGTTCC -3'
(R):5'- TGAAACCTCCTGCTCCCCATAGATG -3'

Sequencing Primer
(F):5'- GACTTGCAGTTCCAGCATCAG -3'
(R):5'- TCCCCATAGATGACTCGGAG -3'
Posted On2013-07-11