Incidental Mutation 'R7404:Cyp3a25'
ID574412
Institutional Source Beutler Lab
Gene Symbol Cyp3a25
Ensembl Gene ENSMUSG00000029630
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 25
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7404 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location145977194-146009618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 145986825 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 336 (D336V)
Ref Sequence ENSEMBL: ENSMUSP00000065585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068317] [ENSMUST00000138870] [ENSMUST00000145062]
Predicted Effect probably damaging
Transcript: ENSMUST00000068317
AA Change: D336V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065585
Gene: ENSMUSG00000029630
AA Change: D336V

DomainStartEndE-ValueType
Pfam:p450 38 493 9.4e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138870
SMART Domains Protein: ENSMUSP00000116077
Gene: ENSMUSG00000029630

DomainStartEndE-ValueType
Pfam:p450 38 126 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145062
SMART Domains Protein: ENSMUSP00000123615
Gene: ENSMUSG00000029630

DomainStartEndE-ValueType
Pfam:p450 38 148 3.9e-21 PFAM
Meta Mutation Damage Score 0.8188 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (92/93)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
Ablim3 C T 18: 61,822,028 A297T probably damaging Het
Adprhl1 T A 8: 13,225,118 S547C probably damaging Het
Ankrd63 G C 2: 118,703,312 R43G unknown Het
Asah2 T C 19: 32,057,854 T24A probably benign Het
Asb17 G A 3: 153,844,810 probably null Het
Atp8b5 C T 4: 43,342,640 T437I probably benign Het
Bbs2 T C 8: 94,082,364 D311G probably damaging Het
Birc6 C T 17: 74,639,794 T2851I possibly damaging Het
Cchcr1 T C 17: 35,524,796 W266R probably benign Het
Col14a1 C A 15: 55,388,628 S560* probably null Het
Crocc G A 4: 141,026,186 T1317M possibly damaging Het
Cxxc1 T A 18: 74,219,207 V334E possibly damaging Het
D430042O09Rik A T 7: 125,865,262 N1267I probably damaging Het
Dapk1 A G 13: 60,719,641 T221A probably benign Het
Dnah11 G T 12: 118,104,808 T1605K probably benign Het
Dnah7c T C 1: 46,666,063 V2412A possibly damaging Het
Ect2l T A 10: 18,159,781 D524V probably damaging Het
Ehbp1l1 T C 19: 5,720,844 E223G possibly damaging Het
Ephb2 A T 4: 136,771,213 M185K probably damaging Het
Fcer1a T C 1: 173,221,516 K243E probably damaging Het
Fcgbp T A 7: 28,101,507 I1326N probably damaging Het
Fgfr1 T C 8: 25,555,550 V45A probably benign Het
Filip1 T A 9: 79,820,098 E413V possibly damaging Het
Frs3 T C 17: 47,702,726 probably null Het
Fstl4 A G 11: 53,134,071 T257A probably benign Het
Gm15922 T C 7: 3,739,345 Y61C probably damaging Het
Golga5 A T 12: 102,484,519 K477M probably damaging Het
Gpr171 A T 3: 59,098,201 I51K probably damaging Het
H1f0 T A 15: 79,028,880 Y53* probably null Het
Hephl1 A G 9: 15,069,751 V795A possibly damaging Het
Hmcn1 A T 1: 150,720,759 D1775E probably benign Het
Hs3st2 A G 7: 121,500,945 D338G possibly damaging Het
Hsd3b6 T A 3: 98,806,218 Y255F probably benign Het
Hspa9 T C 18: 34,943,276 N328D possibly damaging Het
Hvcn1 T A 5: 122,237,685 I100N probably damaging Het
Ifi207 C T 1: 173,728,928 S748N possibly damaging Het
Kcnma1 G T 14: 24,002,834 T180K unknown Het
Kctd16 A G 18: 40,258,773 D138G probably damaging Het
Kifc3 A G 8: 95,103,464 Y605H probably benign Het
Kmt2d T A 15: 98,845,495 Q3928L unknown Het
Lamb2 C T 9: 108,487,583 R1179C probably damaging Het
Layn T A 9: 51,057,370 I358F possibly damaging Het
Lrig1 G A 6: 94,626,471 T232M probably damaging Het
Lrp1 T C 10: 127,582,708 T38A Het
Map3k14 A G 11: 103,239,092 V333A probably benign Het
Med13 T C 11: 86,286,446 D1608G possibly damaging Het
Mrps31 T G 8: 22,421,413 S224A probably benign Het
Msh6 G T 17: 87,975,120 Het
Ncapd3 A G 9: 27,067,019 D838G probably benign Het
Nlrp1a C A 11: 71,097,093 E1184* probably null Het
Npat T A 9: 53,554,933 probably null Het
Nup210 A T 6: 91,073,245 I414N probably benign Het
Olfr1097 A C 2: 86,890,873 L101V probably benign Het
Olfr1346 T C 7: 6,474,164 L18P probably damaging Het
Olfr1484 T A 19: 13,585,388 I28N possibly damaging Het
Olfr187 T C 16: 59,036,240 T166A possibly damaging Het
Olfr378 A T 11: 73,425,593 L130H probably damaging Het
Olfr666 A T 7: 104,892,974 V218E possibly damaging Het
Olfr876 A T 9: 37,803,961 T17S possibly damaging Het
Otud7b G C 3: 96,136,625 probably null Het
Phf11d A C 14: 59,359,493 W86G probably benign Het
Pik3c2b T A 1: 133,090,706 S964T probably damaging Het
Plod3 G A 5: 136,995,047 V687I probably benign Het
Poglut1 T G 16: 38,537,922 Y208S possibly damaging Het
Pou1f1 T A 16: 65,533,863 L253H probably damaging Het
Pou2f1 C T 1: 165,911,386 A166T unknown Het
Rhbdl3 C T 11: 80,346,833 S297L probably damaging Het
Rxra A T 2: 27,741,854 N179I probably damaging Het
Ryr2 C T 13: 11,735,620 E1922K probably damaging Het
Scube1 T C 15: 83,615,010 Y668C probably damaging Het
Sec16b A G 1: 157,531,357 Y120C probably damaging Het
Sec61b G T 4: 47,483,047 K92N probably damaging Het
Slc13a3 T C 2: 165,434,064 N254S possibly damaging Het
Slc17a7 T A 7: 45,172,930 Y397N probably benign Het
Slc25a3 A G 10: 91,117,040 V333A possibly damaging Het
Slc7a8 A T 14: 54,726,826 V390E probably damaging Het
Sorbs2 G A 8: 45,759,196 probably null Het
Srgap1 T C 10: 121,785,745 N948D probably benign Het
Tacc2 A T 7: 130,623,336 T584S probably benign Het
Tec A T 5: 72,763,618 D471E probably damaging Het
Tecpr2 C T 12: 110,931,604 A430V probably benign Het
Tmcc2 A T 1: 132,361,021 D309E probably damaging Het
Tmem82 G A 4: 141,617,431 A67V possibly damaging Het
Ttc23l T C 15: 10,551,577 Q21R probably damaging Het
Ttc37 T A 13: 76,148,747 Y1074* probably null Het
Ubl3 A G 5: 148,511,954 F26L probably damaging Het
Upf2 A G 2: 6,040,203 E1088G unknown Het
Usp9y T A Y: 1,341,780 I1362F probably benign Het
Wnk4 T A 11: 101,268,492 probably null Het
Wrn C G 8: 33,248,966 W1278S probably benign Het
Zfc3h1 T A 10: 115,415,248 V1248D probably damaging Het
Zfp12 T A 5: 143,240,344 V56D probably damaging Het
Other mutations in Cyp3a25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cyp3a25 APN 5 146001463 nonsense probably null
IGL00430:Cyp3a25 APN 5 145993360 missense probably damaging 1.00
IGL00803:Cyp3a25 APN 5 146001443 splice site probably benign
IGL00928:Cyp3a25 APN 5 145986954 missense possibly damaging 0.94
IGL01557:Cyp3a25 APN 5 145984901 missense probably damaging 1.00
IGL01997:Cyp3a25 APN 5 145994956 missense possibly damaging 0.92
IGL02140:Cyp3a25 APN 5 146009463 splice site probably benign
IGL02267:Cyp3a25 APN 5 145998552 missense possibly damaging 0.48
IGL02272:Cyp3a25 APN 5 145993265 intron probably benign
IGL02327:Cyp3a25 APN 5 145986921 missense possibly damaging 0.50
IGL02411:Cyp3a25 APN 5 146001447 critical splice donor site probably benign
IGL02504:Cyp3a25 APN 5 145993331 missense probably benign 0.03
IGL02653:Cyp3a25 APN 5 146003110 missense possibly damaging 0.95
R0378:Cyp3a25 UTSW 5 145986842 missense probably damaging 1.00
R0403:Cyp3a25 UTSW 5 145998513 missense probably damaging 1.00
R0685:Cyp3a25 UTSW 5 145998546 missense probably damaging 1.00
R0725:Cyp3a25 UTSW 5 145994936 missense probably damaging 1.00
R0798:Cyp3a25 UTSW 5 145991533 missense probably damaging 0.98
R1061:Cyp3a25 UTSW 5 145986833 missense probably benign
R1519:Cyp3a25 UTSW 5 146001447 critical splice donor site probably null
R1628:Cyp3a25 UTSW 5 146001463 nonsense probably null
R1822:Cyp3a25 UTSW 5 145984953 missense probably damaging 1.00
R1824:Cyp3a25 UTSW 5 145984953 missense probably damaging 1.00
R1864:Cyp3a25 UTSW 5 145994929 missense probably damaging 0.98
R2062:Cyp3a25 UTSW 5 145986969 splice site probably benign
R2401:Cyp3a25 UTSW 5 145986968 critical splice acceptor site probably null
R2516:Cyp3a25 UTSW 5 146003027 splice site probably null
R3080:Cyp3a25 UTSW 5 145998531 missense probably benign 0.33
R3236:Cyp3a25 UTSW 5 146003128 splice site probably benign
R3694:Cyp3a25 UTSW 5 145989976 splice site probably null
R3730:Cyp3a25 UTSW 5 146003081 missense probably damaging 1.00
R4112:Cyp3a25 UTSW 5 146003031 missense probably benign 0.18
R4258:Cyp3a25 UTSW 5 145991438 missense probably damaging 1.00
R4651:Cyp3a25 UTSW 5 145994891 missense probably benign 0.01
R4788:Cyp3a25 UTSW 5 145985082 nonsense probably null
R4899:Cyp3a25 UTSW 5 145977671 missense possibly damaging 0.59
R4926:Cyp3a25 UTSW 5 145991456 missense probably damaging 1.00
R4952:Cyp3a25 UTSW 5 145991524 missense probably benign 0.01
R5270:Cyp3a25 UTSW 5 145981502 missense probably benign 0.36
R5595:Cyp3a25 UTSW 5 145994863 critical splice donor site probably null
R5659:Cyp3a25 UTSW 5 145991546 missense possibly damaging 0.69
R5787:Cyp3a25 UTSW 5 145998503 missense probably benign 0.14
R6307:Cyp3a25 UTSW 5 145994956 missense possibly damaging 0.92
R6380:Cyp3a25 UTSW 5 145998547 missense probably damaging 0.99
R7055:Cyp3a25 UTSW 5 145992991 missense probably benign 0.00
R7140:Cyp3a25 UTSW 5 146003045 missense probably benign
R7189:Cyp3a25 UTSW 5 146003060 missense probably benign 0.37
R7201:Cyp3a25 UTSW 5 145991447 missense probably benign 0.22
R7201:Cyp3a25 UTSW 5 146003058 missense probably benign 0.00
R7332:Cyp3a25 UTSW 5 145993007 missense probably damaging 1.00
R7548:Cyp3a25 UTSW 5 145986925 missense probably damaging 0.98
R7607:Cyp3a25 UTSW 5 145984981 missense possibly damaging 0.87
R8022:Cyp3a25 UTSW 5 145977668 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TAACTGTCCAGACACGTGGG -3'
(R):5'- GCTATGATGTTCTGCTTTGACC -3'

Sequencing Primer
(F):5'- TCCAGACACGTGGGGATTG -3'
(R):5'- GCTTTGACCTCCTTATCTGAAATG -3'
Posted On2019-09-13