Incidental Mutation 'R7404:Kifc3'
ID574429
Institutional Source Beutler Lab
Gene Symbol Kifc3
Ensembl Gene ENSMUSG00000031788
Gene Namekinesin family member C3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7404 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location95099828-95202812 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95103464 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 605 (Y605H)
Ref Sequence ENSEMBL: ENSMUSP00000034240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034239] [ENSMUST00000034240] [ENSMUST00000169353] [ENSMUST00000169748] [ENSMUST00000212968] [ENSMUST00000213004]
Predicted Effect probably benign
Transcript: ENSMUST00000034239
SMART Domains Protein: ENSMUSP00000034239
Gene: ENSMUSG00000031787

DomainStartEndE-ValueType
WD40 9 49 2.61e-3 SMART
WD40 52 91 2.45e-8 SMART
WD40 94 133 3.58e-10 SMART
WD40 136 175 7.49e-13 SMART
WD40 178 217 5.14e-11 SMART
WD40 220 258 1.14e-3 SMART
low complexity region 354 373 N/A INTRINSIC
low complexity region 396 412 N/A INTRINSIC
Pfam:Katanin_con80 496 654 8.2e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034240
AA Change: Y605H

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000034240
Gene: ENSMUSG00000031788
AA Change: Y605H

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
coiled coil region 100 360 N/A INTRINSIC
coiled coil region 393 430 N/A INTRINSIC
KISc 441 774 3.15e-158 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000127427
Gene: ENSMUSG00000031788
AA Change: Y490H

DomainStartEndE-ValueType
coiled coil region 33 223 N/A INTRINSIC
coiled coil region 256 293 N/A INTRINSIC
KISc 304 637 3.15e-158 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169748
AA Change: Y559H

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126784
Gene: ENSMUSG00000031788
AA Change: Y559H

DomainStartEndE-ValueType
coiled coil region 34 324 N/A INTRINSIC
coiled coil region 357 394 N/A INTRINSIC
KISc 405 728 3.11e-148 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212968
Predicted Effect probably benign
Transcript: ENSMUST00000213004
AA Change: Y468H

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.1901 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (92/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin-14 family of microtubule motors. Members of this family play a role in the formation, maintenance and remodeling of the bipolar mitotic spindle. The protein encoded by this gene has cytoplasmic functions in the interphase cells. It may also be involved in the final stages of cytokinesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and appear phenotypically indistinguishable from wild-type littermates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
Ablim3 C T 18: 61,822,028 A297T probably damaging Het
Adprhl1 T A 8: 13,225,118 S547C probably damaging Het
Ankrd63 G C 2: 118,703,312 R43G unknown Het
Asah2 T C 19: 32,057,854 T24A probably benign Het
Asb17 G A 3: 153,844,810 probably null Het
Atp8b5 C T 4: 43,342,640 T437I probably benign Het
Bbs2 T C 8: 94,082,364 D311G probably damaging Het
Birc6 C T 17: 74,639,794 T2851I possibly damaging Het
Cchcr1 T C 17: 35,524,796 W266R probably benign Het
Col14a1 C A 15: 55,388,628 S560* probably null Het
Crocc G A 4: 141,026,186 T1317M possibly damaging Het
Cxxc1 T A 18: 74,219,207 V334E possibly damaging Het
Cyp3a25 T A 5: 145,986,825 D336V probably damaging Het
D430042O09Rik A T 7: 125,865,262 N1267I probably damaging Het
Dapk1 A G 13: 60,719,641 T221A probably benign Het
Dnah11 G T 12: 118,104,808 T1605K probably benign Het
Dnah7c T C 1: 46,666,063 V2412A possibly damaging Het
Ect2l T A 10: 18,159,781 D524V probably damaging Het
Ehbp1l1 T C 19: 5,720,844 E223G possibly damaging Het
Ephb2 A T 4: 136,771,213 M185K probably damaging Het
Fcer1a T C 1: 173,221,516 K243E probably damaging Het
Fcgbp T A 7: 28,101,507 I1326N probably damaging Het
Fgfr1 T C 8: 25,555,550 V45A probably benign Het
Filip1 T A 9: 79,820,098 E413V possibly damaging Het
Frs3 T C 17: 47,702,726 probably null Het
Fstl4 A G 11: 53,134,071 T257A probably benign Het
Gm15922 T C 7: 3,739,345 Y61C probably damaging Het
Golga5 A T 12: 102,484,519 K477M probably damaging Het
Gpr171 A T 3: 59,098,201 I51K probably damaging Het
H1f0 T A 15: 79,028,880 Y53* probably null Het
Hephl1 A G 9: 15,069,751 V795A possibly damaging Het
Hmcn1 A T 1: 150,720,759 D1775E probably benign Het
Hs3st2 A G 7: 121,500,945 D338G possibly damaging Het
Hsd3b6 T A 3: 98,806,218 Y255F probably benign Het
Hspa9 T C 18: 34,943,276 N328D possibly damaging Het
Hvcn1 T A 5: 122,237,685 I100N probably damaging Het
Ifi207 C T 1: 173,728,928 S748N possibly damaging Het
Kcnma1 G T 14: 24,002,834 T180K unknown Het
Kctd16 A G 18: 40,258,773 D138G probably damaging Het
Kmt2d T A 15: 98,845,495 Q3928L unknown Het
Lamb2 C T 9: 108,487,583 R1179C probably damaging Het
Layn T A 9: 51,057,370 I358F possibly damaging Het
Lrig1 G A 6: 94,626,471 T232M probably damaging Het
Lrp1 T C 10: 127,582,708 T38A Het
Map3k14 A G 11: 103,239,092 V333A probably benign Het
Med13 T C 11: 86,286,446 D1608G possibly damaging Het
Mrps31 T G 8: 22,421,413 S224A probably benign Het
Msh6 G T 17: 87,975,120 Het
Ncapd3 A G 9: 27,067,019 D838G probably benign Het
Nlrp1a C A 11: 71,097,093 E1184* probably null Het
Npat T A 9: 53,554,933 probably null Het
Nup210 A T 6: 91,073,245 I414N probably benign Het
Olfr1097 A C 2: 86,890,873 L101V probably benign Het
Olfr1346 T C 7: 6,474,164 L18P probably damaging Het
Olfr1484 T A 19: 13,585,388 I28N possibly damaging Het
Olfr187 T C 16: 59,036,240 T166A possibly damaging Het
Olfr378 A T 11: 73,425,593 L130H probably damaging Het
Olfr666 A T 7: 104,892,974 V218E possibly damaging Het
Olfr876 A T 9: 37,803,961 T17S possibly damaging Het
Otud7b G C 3: 96,136,625 probably null Het
Phf11d A C 14: 59,359,493 W86G probably benign Het
Pik3c2b T A 1: 133,090,706 S964T probably damaging Het
Plod3 G A 5: 136,995,047 V687I probably benign Het
Poglut1 T G 16: 38,537,922 Y208S possibly damaging Het
Pou1f1 T A 16: 65,533,863 L253H probably damaging Het
Pou2f1 C T 1: 165,911,386 A166T unknown Het
Rhbdl3 C T 11: 80,346,833 S297L probably damaging Het
Rxra A T 2: 27,741,854 N179I probably damaging Het
Ryr2 C T 13: 11,735,620 E1922K probably damaging Het
Scube1 T C 15: 83,615,010 Y668C probably damaging Het
Sec16b A G 1: 157,531,357 Y120C probably damaging Het
Sec61b G T 4: 47,483,047 K92N probably damaging Het
Slc13a3 T C 2: 165,434,064 N254S possibly damaging Het
Slc17a7 T A 7: 45,172,930 Y397N probably benign Het
Slc25a3 A G 10: 91,117,040 V333A possibly damaging Het
Slc7a8 A T 14: 54,726,826 V390E probably damaging Het
Sorbs2 G A 8: 45,759,196 probably null Het
Srgap1 T C 10: 121,785,745 N948D probably benign Het
Tacc2 A T 7: 130,623,336 T584S probably benign Het
Tec A T 5: 72,763,618 D471E probably damaging Het
Tecpr2 C T 12: 110,931,604 A430V probably benign Het
Tmcc2 A T 1: 132,361,021 D309E probably damaging Het
Tmem82 G A 4: 141,617,431 A67V possibly damaging Het
Ttc23l T C 15: 10,551,577 Q21R probably damaging Het
Ttc37 T A 13: 76,148,747 Y1074* probably null Het
Ubl3 A G 5: 148,511,954 F26L probably damaging Het
Upf2 A G 2: 6,040,203 E1088G unknown Het
Usp9y T A Y: 1,341,780 I1362F probably benign Het
Wnk4 T A 11: 101,268,492 probably null Het
Wrn C G 8: 33,248,966 W1278S probably benign Het
Zfc3h1 T A 10: 115,415,248 V1248D probably damaging Het
Zfp12 T A 5: 143,240,344 V56D probably damaging Het
Other mutations in Kifc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00720:Kifc3 APN 8 95138016 missense probably damaging 1.00
IGL01904:Kifc3 APN 8 95137957 missense possibly damaging 0.81
IGL02019:Kifc3 APN 8 95107540 splice site probably benign
IGL02090:Kifc3 APN 8 95102480 missense probably damaging 1.00
IGL02355:Kifc3 APN 8 95109879 missense probably damaging 1.00
IGL02362:Kifc3 APN 8 95109879 missense probably damaging 1.00
IGL02620:Kifc3 APN 8 95109954 missense probably damaging 0.98
IGL02720:Kifc3 APN 8 95108365 missense probably benign 0.00
IGL03030:Kifc3 APN 8 95102412 missense probably damaging 1.00
IGL03327:Kifc3 APN 8 95108432 missense probably damaging 1.00
IGL03390:Kifc3 APN 8 95108613 missense probably damaging 1.00
R0233:Kifc3 UTSW 8 95101472 splice site probably null
R0281:Kifc3 UTSW 8 95103460 missense probably damaging 1.00
R0302:Kifc3 UTSW 8 95103470 missense possibly damaging 0.50
R0619:Kifc3 UTSW 8 95102665 missense probably benign 0.13
R0731:Kifc3 UTSW 8 95105733 missense probably damaging 1.00
R1017:Kifc3 UTSW 8 95105785 missense probably damaging 0.99
R1147:Kifc3 UTSW 8 95137918 missense probably damaging 1.00
R1147:Kifc3 UTSW 8 95137918 missense probably damaging 1.00
R1257:Kifc3 UTSW 8 95105772 missense probably damaging 0.98
R1472:Kifc3 UTSW 8 95137913 critical splice donor site probably null
R1480:Kifc3 UTSW 8 95109887 missense probably damaging 1.00
R1553:Kifc3 UTSW 8 95106542 missense possibly damaging 0.67
R2071:Kifc3 UTSW 8 95108353 critical splice donor site probably null
R2115:Kifc3 UTSW 8 95108713 missense probably damaging 1.00
R3703:Kifc3 UTSW 8 95104028 splice site probably benign
R3704:Kifc3 UTSW 8 95104028 splice site probably benign
R3705:Kifc3 UTSW 8 95104028 splice site probably benign
R4223:Kifc3 UTSW 8 95109982 missense probably damaging 0.96
R4463:Kifc3 UTSW 8 95102116 missense probably damaging 1.00
R4508:Kifc3 UTSW 8 95107420 splice site probably null
R4980:Kifc3 UTSW 8 95126549 missense probably benign
R5032:Kifc3 UTSW 8 95102726 missense probably damaging 1.00
R5068:Kifc3 UTSW 8 95110216 missense possibly damaging 0.54
R5421:Kifc3 UTSW 8 95109845 missense probably damaging 0.99
R5556:Kifc3 UTSW 8 95108459 nonsense probably null
R6845:Kifc3 UTSW 8 95108679 missense probably benign 0.28
R7136:Kifc3 UTSW 8 95103449 missense probably benign 0.10
R7196:Kifc3 UTSW 8 95106611 missense probably benign 0.02
R7441:Kifc3 UTSW 8 95137987 missense probably benign 0.00
R7784:Kifc3 UTSW 8 95110692 critical splice donor site probably null
R7861:Kifc3 UTSW 8 95107537 critical splice acceptor site probably null
R8440:Kifc3 UTSW 8 95109794 missense possibly damaging 0.89
R8754:Kifc3 UTSW 8 95102396 missense probably damaging 1.00
X0023:Kifc3 UTSW 8 95109298 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGATACTCAAGTTTCTTCAAGGT -3'
(R):5'- TGCAAGTCCTGTGGTCCAG -3'

Sequencing Primer
(F):5'- CCTTTCCTTTCAGATGAGGAGACAG -3'
(R):5'- CCAGGATTGGTGCAGGG -3'
Posted On2019-09-13