Incidental Mutation 'R0625:Usp7'
ID57443
Institutional Source Beutler Lab
Gene Symbol Usp7
Ensembl Gene ENSMUSG00000022710
Gene Nameubiquitin specific peptidase 7
Synonyms2210010O09Rik
MMRRC Submission 038814-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0625 (G1)
Quality Score151
Status Not validated
Chromosome16
Chromosomal Location8689595-8792308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 8704982 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 102 (D102N)
Ref Sequence ENSEMBL: ENSMUSP00000133398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160326] [ENSMUST00000160405] [ENSMUST00000161046] [ENSMUST00000172505]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159509
Predicted Effect probably benign
Transcript: ENSMUST00000160326
SMART Domains Protein: ENSMUSP00000124576
Gene: ENSMUSG00000022710

DomainStartEndE-ValueType
PDB:2F1Z|B 43 83 2e-18 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160405
AA Change: D383N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124382
Gene: ENSMUSG00000022710
AA Change: D383N

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
MATH 111 217 4.27e-22 SMART
Pfam:UCH 254 559 5.7e-53 PFAM
Pfam:UCH_1 255 528 3.7e-22 PFAM
Pfam:USP7_ICP0_bdg 661 906 7.1e-79 PFAM
Pfam:USP7_C2 916 1127 4.9e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161046
AA Change: D343N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124093
Gene: ENSMUSG00000022710
AA Change: D343N

DomainStartEndE-ValueType
MATH 71 177 4.27e-22 SMART
Pfam:UCH 214 519 9.6e-60 PFAM
Pfam:UCH_1 215 488 5.1e-29 PFAM
Pfam:USP7_ICP0_bdg 620 866 5e-83 PFAM
Pfam:USP7_C2 875 1089 2.7e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162445
Predicted Effect probably benign
Transcript: ENSMUST00000172505
AA Change: D102N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133398
Gene: ENSMUSG00000022710
AA Change: D102N

DomainStartEndE-ValueType
Pfam:UCH_1 5 247 1.7e-18 PFAM
Pfam:UCH 5 278 2.8e-47 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the peptidase C19 family, which includes ubiquitinyl hydrolases. This protein deubiquitinates target proteins such as p53 (a tumor suppressor protein) and WASH (essential for endosomal protein recycling), and regulates their activities by counteracting the opposing ubiquitin ligase activity of proteins such as HDM2 and TRIM27, involved in the respective process. Mutations in this gene have been implicated in a neurodevelopmental disorder. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null allele show embryonic growth arrest and die between E6.5 and E7.5. Mice homozygous for a conditional allele activated in neural cells exhibit complete neonatal lethality, absent gastric milk, uncoordinated movement and abnormalforebrain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T C 9: 53,408,065 S2P probably benign Het
Abca16 A C 7: 120,435,893 T301P probably damaging Het
Acer2 A G 4: 86,887,162 D121G possibly damaging Het
Adgrd1 T C 5: 129,171,931 probably null Het
Arhgap11a T C 2: 113,841,711 I249V probably benign Het
Arhgap22 A G 14: 33,366,714 E219G probably benign Het
C2cd4b T A 9: 67,759,751 S10T probably benign Het
Cnot6 A T 11: 49,683,171 I224N probably damaging Het
Ctrc T C 4: 141,841,518 T125A probably damaging Het
Cxxc5 T G 18: 35,858,589 S14R unknown Het
Cyp4f37 T G 17: 32,634,678 F445L probably damaging Het
Dcbld1 T G 10: 52,312,850 I186S probably benign Het
Dmxl2 T C 9: 54,382,702 T2510A probably benign Het
Dnah3 A G 7: 120,071,887 I591T possibly damaging Het
Dock5 A T 14: 67,841,163 I204N probably benign Het
Dysf G A 6: 84,111,987 probably null Het
Erich5 A G 15: 34,471,369 E248G probably damaging Het
Fam160a1 A G 3: 85,730,500 V164A possibly damaging Het
Foxm1 A G 6: 128,373,871 S712G probably damaging Het
Frmpd1 A G 4: 45,284,055 T959A probably benign Het
Gfra4 C T 2: 131,040,256 V277I probably null Het
Hacd4 T C 4: 88,435,010 I82V probably benign Het
Itih2 C T 2: 10,123,414 V159I possibly damaging Het
Itpr2 T A 6: 146,166,651 M2410L probably benign Het
March11 A G 15: 26,311,043 I202V probably damaging Het
March3 A G 18: 56,811,830 probably null Het
Med12l G A 3: 59,247,437 E1135K probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlx T C 11: 101,087,782 L78P possibly damaging Het
Muc5b T C 7: 141,846,427 C473R unknown Het
N4bp2l1 T A 5: 150,576,745 R66* probably null Het
Nes A G 3: 87,977,172 T913A possibly damaging Het
Oas1a T C 5: 120,899,259 E235G probably damaging Het
Olfr1104 T A 2: 87,021,620 H308L probably benign Het
Olfr477 T C 7: 107,991,189 S275P probably damaging Het
Olfr905 T C 9: 38,473,208 S154P possibly damaging Het
Parn C T 16: 13,640,294 V286I probably benign Het
Paxip1 G A 5: 27,765,942 Q470* probably null Het
Phc2 C G 4: 128,723,710 H510D possibly damaging Het
Pla2g4f T A 2: 120,305,041 D384V probably damaging Het
Plpbp A T 8: 27,045,131 N68I probably damaging Het
Podxl2 G A 6: 88,849,955 A123V possibly damaging Het
Pole A T 5: 110,325,550 T1737S possibly damaging Het
Ppp3cc T C 14: 70,225,027 E396G probably damaging Het
Pramel7 T A 2: 87,491,008 I228F probably benign Het
Prl7d1 A T 13: 27,710,140 C149S probably benign Het
Qtrt1 G T 9: 21,418,288 M217I probably benign Het
Sec24a T A 11: 51,729,454 D456V probably damaging Het
Shox2 T G 3: 66,981,544 probably null Het
Skint2 T A 4: 112,624,086 S49T probably damaging Het
Smarca5 A G 8: 80,720,686 probably null Het
Sorcs2 T A 5: 36,024,572 D1068V possibly damaging Het
Tmem114 T C 16: 8,412,102 probably null Het
Ttc7b T A 12: 100,355,046 M24L probably benign Het
Ttll3 A G 6: 113,408,903 probably null Het
Other mutations in Usp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Usp7 APN 16 8697975 missense probably damaging 0.96
IGL00496:Usp7 APN 16 8695113 missense probably damaging 0.99
IGL02113:Usp7 APN 16 8716513 critical splice donor site probably null
IGL02873:Usp7 APN 16 8695194 unclassified probably benign
IGL03036:Usp7 APN 16 8738214 missense probably benign 0.00
PIT4402001:Usp7 UTSW 16 8698495 missense probably benign
R0066:Usp7 UTSW 16 8691418 missense probably benign
R0400:Usp7 UTSW 16 8716632 splice site probably benign
R0483:Usp7 UTSW 16 8699262 missense probably damaging 1.00
R0626:Usp7 UTSW 16 8693914 missense possibly damaging 0.54
R0837:Usp7 UTSW 16 8703502 missense probably damaging 1.00
R0967:Usp7 UTSW 16 8696654 unclassified probably benign
R1929:Usp7 UTSW 16 8698469 missense probably benign 0.00
R2270:Usp7 UTSW 16 8698469 missense probably benign 0.00
R2271:Usp7 UTSW 16 8698469 missense probably benign 0.00
R2272:Usp7 UTSW 16 8698469 missense probably benign 0.00
R3949:Usp7 UTSW 16 8716564 missense probably damaging 1.00
R4411:Usp7 UTSW 16 8708914 missense probably damaging 1.00
R4413:Usp7 UTSW 16 8708914 missense probably damaging 1.00
R4500:Usp7 UTSW 16 8695895 missense possibly damaging 0.89
R4651:Usp7 UTSW 16 8698414 intron probably benign
R4852:Usp7 UTSW 16 8756844 nonsense probably null
R5483:Usp7 UTSW 16 8698540 missense probably benign
R5610:Usp7 UTSW 16 8716510 splice site probably null
R5734:Usp7 UTSW 16 8701981 missense possibly damaging 0.91
R5964:Usp7 UTSW 16 8712102 missense possibly damaging 0.52
R6753:Usp7 UTSW 16 8696911 missense probably benign 0.25
R7171:Usp7 UTSW 16 8716526 missense probably benign 0.01
R7263:Usp7 UTSW 16 8696724 missense possibly damaging 0.89
R7420:Usp7 UTSW 16 8710121 missense probably benign
R7654:Usp7 UTSW 16 8702043 missense probably benign 0.33
R7789:Usp7 UTSW 16 8698811 missense probably benign
R7808:Usp7 UTSW 16 8705163 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCAAGCTGCTGAATGCTAGAG -3'
(R):5'- AGGGCACCATTCCAAAGTTATTCCG -3'

Sequencing Primer
(F):5'- AGGTAGTCACCCAATGTGCTG -3'
(R):5'- TTATTCCGAGGCAAAATGGTG -3'
Posted On2013-07-11