Mutagenetix > Incidental Mutations

Incidental Mutation 'R0625:Usp7'

57443

Institutional Source

Beutler Lab

Gene Symbol

Usp7

Ensembl Gene

ENSMUSG00000022710

Gene Name

ubiquitin specific peptidase 7

Synonyms

2210010O09Rik

MMRRC Submission

038814-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0625 (G1)

Quality Score

151

Status

Not validated

Chromosome

Chromosomal Location

8689595-8792308 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 8704982 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 102 (D102N)

Ref Sequence

ENSEMBL: ENSMUSP00000133398 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160326] [ENSMUST00000160405] [ENSMUST00000161046] [ENSMUST00000172505]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159281

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159287

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159503

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159509

Predicted Effect

probably benign
Transcript: ENSMUST00000160326

SMART Domains

Protein: ENSMUSP00000124576
Gene: ENSMUSG00000022710

Domain	Start	End	E-Value	Type
PDB:2F1Z\|B	43	83	2e-18	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000160405
AA Change: D383N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000124382
Gene: ENSMUSG00000022710
AA Change: D383N

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
MATH	111	217	4.27e-22	SMART
Pfam:UCH	254	559	5.7e-53	PFAM
Pfam:UCH_1	255	528	3.7e-22	PFAM
Pfam:USP7_ICP0_bdg	661	906	7.1e-79	PFAM
Pfam:USP7_C2	916	1127	4.9e-63	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000161046
AA Change: D343N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000124093
Gene: ENSMUSG00000022710
AA Change: D343N

Domain	Start	End	E-Value	Type
MATH	71	177	4.27e-22	SMART
Pfam:UCH	214	519	9.6e-60	PFAM
Pfam:UCH_1	215	488	5.1e-29	PFAM
Pfam:USP7_ICP0_bdg	620	866	5e-83	PFAM
Pfam:USP7_C2	875	1089	2.7e-69	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162141

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162445

Predicted Effect

probably benign
Transcript: ENSMUST00000172505
AA Change: D102N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000133398
Gene: ENSMUSG00000022710
AA Change: D102N

Domain	Start	End	E-Value	Type
Pfam:UCH_1	5	247	1.7e-18	PFAM
Pfam:UCH	5	278	2.8e-47	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.5%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the peptidase C19 family, which includes ubiquitinyl hydrolases. This protein deubiquitinates target proteins such as p53 (a tumor suppressor protein) and WASH (essential for endosomal protein recycling), and regulates their activities by counteracting the opposing ubiquitin ligase activity of proteins such as HDM2 and TRIM27, involved in the respective process. Mutations in this gene have been implicated in a neurodevelopmental disorder. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null allele show embryonic growth arrest and die between E6.5 and E7.5. Mice homozygous for a conditional allele activated in neural cells exhibit complete neonatal lethality, absent gastric milk, uncoordinated movement and abnormalforebrain morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930550C14Rik	T	C	9: 53,408,065	S2P	probably benign	Het
Abca16	A	C	7: 120,435,893	T301P	probably damaging	Het
Acer2	A	G	4: 86,887,162	D121G	possibly damaging	Het
Adgrd1	T	C	5: 129,171,931		probably null	Het
Arhgap11a	T	C	2: 113,841,711	I249V	probably benign	Het
Arhgap22	A	G	14: 33,366,714	E219G	probably benign	Het
C2cd4b	T	A	9: 67,759,751	S10T	probably benign	Het
Cnot6	A	T	11: 49,683,171	I224N	probably damaging	Het
Ctrc	T	C	4: 141,841,518	T125A	probably damaging	Het
Cxxc5	T	G	18: 35,858,589	S14R	unknown	Het
Cyp4f37	T	G	17: 32,634,678	F445L	probably damaging	Het
Dcbld1	T	G	10: 52,312,850	I186S	probably benign	Het
Dmxl2	T	C	9: 54,382,702	T2510A	probably benign	Het
Dnah3	A	G	7: 120,071,887	I591T	possibly damaging	Het
Dock5	A	T	14: 67,841,163	I204N	probably benign	Het
Dysf	G	A	6: 84,111,987		probably null	Het
Erich5	A	G	15: 34,471,369	E248G	probably damaging	Het
Fam160a1	A	G	3: 85,730,500	V164A	possibly damaging	Het
Foxm1	A	G	6: 128,373,871	S712G	probably damaging	Het
Frmpd1	A	G	4: 45,284,055	T959A	probably benign	Het
Gfra4	C	T	2: 131,040,256	V277I	probably null	Het
Hacd4	T	C	4: 88,435,010	I82V	probably benign	Het
Itih2	C	T	2: 10,123,414	V159I	possibly damaging	Het
Itpr2	T	A	6: 146,166,651	M2410L	probably benign	Het
March11	A	G	15: 26,311,043	I202V	probably damaging	Het
March3	A	G	18: 56,811,830		probably null	Het
Med12l	G	A	3: 59,247,437	E1135K	probably damaging	Het
Mib2	C	T	4: 155,659,460	G42S	probably damaging	Het
Mlx	T	C	11: 101,087,782	L78P	possibly damaging	Het
Muc5b	T	C	7: 141,846,427	C473R	unknown	Het
N4bp2l1	T	A	5: 150,576,745	R66*	probably null	Het
Nes	A	G	3: 87,977,172	T913A	possibly damaging	Het
Oas1a	T	C	5: 120,899,259	E235G	probably damaging	Het
Olfr1104	T	A	2: 87,021,620	H308L	probably benign	Het
Olfr477	T	C	7: 107,991,189	S275P	probably damaging	Het
Olfr905	T	C	9: 38,473,208	S154P	possibly damaging	Het
Parn	C	T	16: 13,640,294	V286I	probably benign	Het
Paxip1	G	A	5: 27,765,942	Q470*	probably null	Het
Phc2	C	G	4: 128,723,710	H510D	possibly damaging	Het
Pla2g4f	T	A	2: 120,305,041	D384V	probably damaging	Het
Plpbp	A	T	8: 27,045,131	N68I	probably damaging	Het
Podxl2	G	A	6: 88,849,955	A123V	possibly damaging	Het
Pole	A	T	5: 110,325,550	T1737S	possibly damaging	Het
Ppp3cc	T	C	14: 70,225,027	E396G	probably damaging	Het
Pramel7	T	A	2: 87,491,008	I228F	probably benign	Het
Prl7d1	A	T	13: 27,710,140	C149S	probably benign	Het
Qtrt1	G	T	9: 21,418,288	M217I	probably benign	Het
Sec24a	T	A	11: 51,729,454	D456V	probably damaging	Het
Shox2	T	G	3: 66,981,544		probably null	Het
Skint2	T	A	4: 112,624,086	S49T	probably damaging	Het
Smarca5	A	G	8: 80,720,686		probably null	Het
Sorcs2	T	A	5: 36,024,572	D1068V	possibly damaging	Het
Tmem114	T	C	16: 8,412,102		probably null	Het
Ttc7b	T	A	12: 100,355,046	M24L	probably benign	Het
Ttll3	A	G	6: 113,408,903		probably null	Het

Other mutations in Usp7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00477:Usp7	APN	16	8697975	missense	probably damaging	0.96
IGL00496:Usp7	APN	16	8695113	missense	probably damaging	0.99
IGL02113:Usp7	APN	16	8716513	critical splice donor site	probably null
IGL02873:Usp7	APN	16	8695194	unclassified	probably benign
IGL03036:Usp7	APN	16	8738214	missense	probably benign	0.00
PIT4402001:Usp7	UTSW	16	8698495	missense	probably benign
R0066:Usp7	UTSW	16	8691418	missense	probably benign
R0400:Usp7	UTSW	16	8716632	splice site	probably benign
R0483:Usp7	UTSW	16	8699262	missense	probably damaging	1.00
R0626:Usp7	UTSW	16	8693914	missense	possibly damaging	0.54
R0837:Usp7	UTSW	16	8703502	missense	probably damaging	1.00
R0967:Usp7	UTSW	16	8696654	unclassified	probably benign
R1929:Usp7	UTSW	16	8698469	missense	probably benign	0.00
R2270:Usp7	UTSW	16	8698469	missense	probably benign	0.00
R2271:Usp7	UTSW	16	8698469	missense	probably benign	0.00
R2272:Usp7	UTSW	16	8698469	missense	probably benign	0.00
R3949:Usp7	UTSW	16	8716564	missense	probably damaging	1.00
R4411:Usp7	UTSW	16	8708914	missense	probably damaging	1.00
R4413:Usp7	UTSW	16	8708914	missense	probably damaging	1.00
R4500:Usp7	UTSW	16	8695895	missense	possibly damaging	0.89
R4651:Usp7	UTSW	16	8698414	intron	probably benign
R4852:Usp7	UTSW	16	8756844	nonsense	probably null
R5483:Usp7	UTSW	16	8698540	missense	probably benign
R5610:Usp7	UTSW	16	8716510	splice site	probably null
R5734:Usp7	UTSW	16	8701981	missense	possibly damaging	0.91
R5964:Usp7	UTSW	16	8712102	missense	possibly damaging	0.52
R6753:Usp7	UTSW	16	8696911	missense	probably benign	0.25
R7171:Usp7	UTSW	16	8716526	missense	probably benign	0.01
R7263:Usp7	UTSW	16	8696724	missense	possibly damaging	0.89
R7420:Usp7	UTSW	16	8710121	missense	probably benign
R7654:Usp7	UTSW	16	8702043	missense	probably benign	0.33
R7789:Usp7	UTSW	16	8698811	missense	probably benign
R7808:Usp7	UTSW	16	8705163	missense	probably damaging	1.00
R8080:Usp7	UTSW	16	8697907	missense	probably benign	0.42
R8353:Usp7	UTSW	16	8695871	missense	probably benign	0.01
R8502:Usp7	UTSW	16	8695029	critical splice donor site	probably null
R8548:Usp7	UTSW	16	8712075	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- AGCCCAAGCTGCTGAATGCTAGAG -3'
(R):5'- AGGGCACCATTCCAAAGTTATTCCG -3'

Sequencing Primer
(F):5'- AGGTAGTCACCCAATGTGCTG -3'
(R):5'- TTATTCCGAGGCAAAATGGTG -3'

Posted On

2013-07-11