Incidental Mutation 'R7404:Dapk1'
ID574452
Institutional Source Beutler Lab
Gene Symbol Dapk1
Ensembl Gene ENSMUSG00000021559
Gene Namedeath associated protein kinase 1
SynonymsDAP-Kinase, 2310039H24Rik, D13Ucla1, 2810425C21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7404 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location60601947-60763191 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60719641 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 221 (T221A)
Ref Sequence ENSEMBL: ENSMUSP00000076666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044083] [ENSMUST00000077453] [ENSMUST00000226059]
Predicted Effect probably benign
Transcript: ENSMUST00000044083
AA Change: T221A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000040825
Gene: ENSMUSG00000021559
AA Change: T221A

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077453
AA Change: T221A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000076666
Gene: ENSMUSG00000021559
AA Change: T221A

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
Pfam:COR 984 1176 4.2e-10 PFAM
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224789
Predicted Effect probably benign
Transcript: ENSMUST00000226059
AA Change: T221A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Death-associated protein kinase 1 is a positive mediator of gamma-interferon induced programmed cell death. DAPK1 encodes a structurally unique 160-kD calmodulin dependent serine-threonine kinase that carries 8 ankyrin repeats and 2 putative P-loop consensus sites. It is a tumor suppressor candidate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased sensitivity to ER stress-induced cell death and reduced tunicamycin-induced kidney damage. Mice homozygous for a gene trapped allele show decreased infarct size and neuronal death with improved neurological scores after ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
Ablim3 C T 18: 61,822,028 A297T probably damaging Het
Adprhl1 T A 8: 13,225,118 S547C probably damaging Het
Ankrd63 G C 2: 118,703,312 R43G unknown Het
Asah2 T C 19: 32,057,854 T24A probably benign Het
Atp8b5 C T 4: 43,342,640 T437I probably benign Het
Bbs2 T C 8: 94,082,364 D311G probably damaging Het
Birc6 C T 17: 74,639,794 T2851I possibly damaging Het
Cchcr1 T C 17: 35,524,796 W266R probably benign Het
Col14a1 C A 15: 55,388,628 S560* probably null Het
Crocc G A 4: 141,026,186 T1317M possibly damaging Het
Cxxc1 T A 18: 74,219,207 V334E possibly damaging Het
Cyp3a25 T A 5: 145,986,825 D336V probably damaging Het
D430042O09Rik A T 7: 125,865,262 N1267I probably damaging Het
Dnah11 G T 12: 118,104,808 T1605K probably benign Het
Dnah7c T C 1: 46,666,063 V2412A possibly damaging Het
Ect2l T A 10: 18,159,781 D524V probably damaging Het
Ehbp1l1 T C 19: 5,720,844 E223G possibly damaging Het
Ephb2 A T 4: 136,771,213 M185K probably damaging Het
Fcer1a T C 1: 173,221,516 K243E probably damaging Het
Fcgbp T A 7: 28,101,507 I1326N probably damaging Het
Fgfr1 T C 8: 25,555,550 V45A probably benign Het
Filip1 T A 9: 79,820,098 E413V possibly damaging Het
Frs3 T C 17: 47,702,726 probably null Het
Fstl4 A G 11: 53,134,071 T257A probably benign Het
Gm15922 T C 7: 3,739,345 Y61C probably damaging Het
Golga5 A T 12: 102,484,519 K477M probably damaging Het
Gpr171 A T 3: 59,098,201 I51K probably damaging Het
H1f0 T A 15: 79,028,880 Y53* probably null Het
Hephl1 A G 9: 15,069,751 V795A possibly damaging Het
Hmcn1 A T 1: 150,720,759 D1775E probably benign Het
Hs3st2 A G 7: 121,500,945 D338G possibly damaging Het
Hsd3b6 T A 3: 98,806,218 Y255F probably benign Het
Hspa9 T C 18: 34,943,276 N328D possibly damaging Het
Hvcn1 T A 5: 122,237,685 I100N probably damaging Het
Ifi207 C T 1: 173,728,928 S748N possibly damaging Het
Kcnma1 G T 14: 24,002,834 T180K unknown Het
Kctd16 A G 18: 40,258,773 D138G probably damaging Het
Kifc3 A G 8: 95,103,464 Y605H probably benign Het
Kmt2d T A 15: 98,845,495 Q3928L unknown Het
Lamb2 C T 9: 108,487,583 R1179C probably damaging Het
Layn T A 9: 51,057,370 I358F possibly damaging Het
Lrig1 G A 6: 94,626,471 T232M probably damaging Het
Lrp1 T C 10: 127,582,708 T38A Het
Map3k14 A G 11: 103,239,092 V333A probably benign Het
Med13 T C 11: 86,286,446 D1608G possibly damaging Het
Mrps31 T G 8: 22,421,413 S224A probably benign Het
Msh6 G T 17: 87,975,120 Het
Ncapd3 A G 9: 27,067,019 D838G probably benign Het
Nlrp1a C A 11: 71,097,093 E1184* probably null Het
Nup210 A T 6: 91,073,245 I414N probably benign Het
Olfr1097 A C 2: 86,890,873 L101V probably benign Het
Olfr1346 T C 7: 6,474,164 L18P probably damaging Het
Olfr1484 T A 19: 13,585,388 I28N possibly damaging Het
Olfr187 T C 16: 59,036,240 T166A possibly damaging Het
Olfr378 A T 11: 73,425,593 L130H probably damaging Het
Olfr666 A T 7: 104,892,974 V218E possibly damaging Het
Olfr876 A T 9: 37,803,961 T17S possibly damaging Het
Otud7b G C 3: 96,136,625 probably null Het
Phf11d A C 14: 59,359,493 W86G probably benign Het
Pik3c2b T A 1: 133,090,706 S964T probably damaging Het
Plod3 G A 5: 136,995,047 V687I probably benign Het
Poglut1 T G 16: 38,537,922 Y208S possibly damaging Het
Pou1f1 T A 16: 65,533,863 L253H probably damaging Het
Pou2f1 C T 1: 165,911,386 A166T unknown Het
Rhbdl3 C T 11: 80,346,833 S297L probably damaging Het
Rxra A T 2: 27,741,854 N179I probably damaging Het
Ryr2 C T 13: 11,735,620 E1922K probably damaging Het
Scube1 T C 15: 83,615,010 Y668C probably damaging Het
Sec16b A G 1: 157,531,357 Y120C probably damaging Het
Sec61b G T 4: 47,483,047 K92N probably damaging Het
Slc13a3 T C 2: 165,434,064 N254S possibly damaging Het
Slc17a7 T A 7: 45,172,930 Y397N probably benign Het
Slc25a3 A G 10: 91,117,040 V333A possibly damaging Het
Slc7a8 A T 14: 54,726,826 V390E probably damaging Het
Srgap1 T C 10: 121,785,745 N948D probably benign Het
Tacc2 A T 7: 130,623,336 T584S probably benign Het
Tec A T 5: 72,763,618 D471E probably damaging Het
Tecpr2 C T 12: 110,931,604 A430V probably benign Het
Tmcc2 A T 1: 132,361,021 D309E probably damaging Het
Tmem82 G A 4: 141,617,431 A67V possibly damaging Het
Ttc23l T C 15: 10,551,577 Q21R probably damaging Het
Ttc37 T A 13: 76,148,747 Y1074* probably null Het
Ubl3 A G 5: 148,511,954 F26L probably damaging Het
Upf2 A G 2: 6,040,203 E1088G unknown Het
Usp9y T A Y: 1,341,780 I1362F probably benign Het
Wnk4 T A 11: 101,268,492 probably null Het
Wrn C G 8: 33,248,966 W1278S probably benign Het
Zfc3h1 T A 10: 115,415,248 V1248D probably damaging Het
Zfp12 T A 5: 143,240,344 V56D probably damaging Het
Other mutations in Dapk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dapk1 APN 13 60761040 missense probably benign 0.23
IGL00500:Dapk1 APN 13 60760804 missense probably damaging 0.96
IGL00801:Dapk1 APN 13 60761248 missense probably benign 0.00
IGL00903:Dapk1 APN 13 60761397 missense probably damaging 0.99
IGL01468:Dapk1 APN 13 60760798 missense probably benign
IGL01535:Dapk1 APN 13 60731031 splice site probably benign
IGL01755:Dapk1 APN 13 60761175 missense probably damaging 0.97
IGL01755:Dapk1 APN 13 60761176 missense possibly damaging 0.63
IGL01862:Dapk1 APN 13 60726610 missense probably benign 0.39
IGL01985:Dapk1 APN 13 60736260 missense probably damaging 1.00
IGL02124:Dapk1 APN 13 60730882 missense probably benign
IGL02376:Dapk1 APN 13 60696394 missense probably benign 0.00
IGL02449:Dapk1 APN 13 60719770 splice site probably benign
IGL02490:Dapk1 APN 13 60749334 missense probably damaging 1.00
IGL02503:Dapk1 APN 13 60761807 nonsense probably null
IGL02516:Dapk1 APN 13 60696347 missense probably damaging 1.00
IGL02544:Dapk1 APN 13 60751217 missense probably benign
IGL02604:Dapk1 APN 13 60748320 missense probably benign
IGL03035:Dapk1 APN 13 60716773 missense probably damaging 0.99
H8562:Dapk1 UTSW 13 60761312 missense probably damaging 0.98
P0026:Dapk1 UTSW 13 60718149 splice site probably benign
R0116:Dapk1 UTSW 13 60761100 missense probably benign
R0165:Dapk1 UTSW 13 60761593 missense probably benign 0.39
R0357:Dapk1 UTSW 13 60729558 nonsense probably null
R0446:Dapk1 UTSW 13 60725287 splice site probably null
R0502:Dapk1 UTSW 13 60730848 synonymous probably null
R0503:Dapk1 UTSW 13 60730848 synonymous probably null
R0597:Dapk1 UTSW 13 60761384 missense probably benign 0.40
R0614:Dapk1 UTSW 13 60718132 missense probably damaging 1.00
R0751:Dapk1 UTSW 13 60696298 missense probably damaging 1.00
R0930:Dapk1 UTSW 13 60757448 missense probably benign 0.14
R1023:Dapk1 UTSW 13 60730985 missense probably damaging 1.00
R1033:Dapk1 UTSW 13 60721865 critical splice donor site probably null
R1101:Dapk1 UTSW 13 60716785 missense probably damaging 1.00
R1184:Dapk1 UTSW 13 60696298 missense probably damaging 1.00
R1430:Dapk1 UTSW 13 60754143 missense probably benign 0.28
R1630:Dapk1 UTSW 13 60729531 missense probably damaging 0.99
R1681:Dapk1 UTSW 13 60718464 critical splice donor site probably null
R1799:Dapk1 UTSW 13 60719654 missense probably damaging 1.00
R2012:Dapk1 UTSW 13 60721857 missense probably damaging 1.00
R2068:Dapk1 UTSW 13 60751208 missense probably damaging 1.00
R2131:Dapk1 UTSW 13 60729531 missense possibly damaging 0.91
R2131:Dapk1 UTSW 13 60761667 missense possibly damaging 0.80
R2154:Dapk1 UTSW 13 60729503 missense probably benign 0.36
R2288:Dapk1 UTSW 13 60761749 missense probably damaging 1.00
R2312:Dapk1 UTSW 13 60757353 missense probably damaging 0.99
R2362:Dapk1 UTSW 13 60730931 missense probably damaging 0.98
R2400:Dapk1 UTSW 13 60752216 missense probably benign 0.34
R2909:Dapk1 UTSW 13 60716817 critical splice donor site probably null
R2926:Dapk1 UTSW 13 60719750 missense possibly damaging 0.58
R3741:Dapk1 UTSW 13 60748200 missense probably benign 0.09
R3810:Dapk1 UTSW 13 60760689 missense probably damaging 0.98
R4374:Dapk1 UTSW 13 60719684 missense probably benign 0.01
R4375:Dapk1 UTSW 13 60761589 missense probably benign
R4377:Dapk1 UTSW 13 60719684 missense probably benign 0.01
R4490:Dapk1 UTSW 13 60718128 missense probably benign 0.26
R4576:Dapk1 UTSW 13 60721822 missense probably benign 0.13
R4599:Dapk1 UTSW 13 60718047 missense probably benign 0.22
R4682:Dapk1 UTSW 13 60751147 missense probably benign 0.41
R4717:Dapk1 UTSW 13 60726662 critical splice donor site probably null
R4775:Dapk1 UTSW 13 60749342 missense probably benign 0.02
R4790:Dapk1 UTSW 13 60723105 frame shift probably null
R4897:Dapk1 UTSW 13 60761786 missense probably benign 0.01
R4931:Dapk1 UTSW 13 60760960 missense probably benign 0.04
R5113:Dapk1 UTSW 13 60721778 missense probably benign 0.01
R5503:Dapk1 UTSW 13 60725312 missense probably benign 0.15
R5948:Dapk1 UTSW 13 60729395 missense probably damaging 0.97
R6012:Dapk1 UTSW 13 60761662 missense probably benign 0.00
R6035:Dapk1 UTSW 13 60761199 missense possibly damaging 0.46
R6035:Dapk1 UTSW 13 60761199 missense possibly damaging 0.46
R6268:Dapk1 UTSW 13 60761766 missense possibly damaging 0.91
R6330:Dapk1 UTSW 13 60761326 missense probably benign 0.01
R6331:Dapk1 UTSW 13 60729442 nonsense probably null
R6553:Dapk1 UTSW 13 60761161 missense probably damaging 0.99
R6598:Dapk1 UTSW 13 60761347 missense probably benign 0.03
R6602:Dapk1 UTSW 13 60749204 missense probably benign 0.20
R6640:Dapk1 UTSW 13 60716814 missense probably damaging 0.99
R6684:Dapk1 UTSW 13 60760894 missense probably damaging 1.00
R6747:Dapk1 UTSW 13 60725340 missense probably benign 0.22
R6799:Dapk1 UTSW 13 60752235 missense probably benign
R6809:Dapk1 UTSW 13 60751289 missense probably benign 0.00
R6915:Dapk1 UTSW 13 60696442 missense probably damaging 1.00
R6949:Dapk1 UTSW 13 60736324 missense probably benign 0.11
R6979:Dapk1 UTSW 13 60748281 missense probably damaging 1.00
R7161:Dapk1 UTSW 13 60696395 missense possibly damaging 0.89
R7171:Dapk1 UTSW 13 60761785 missense probably damaging 0.97
R7199:Dapk1 UTSW 13 60754210 missense probably benign 0.02
R7203:Dapk1 UTSW 13 60696335 missense possibly damaging 0.90
R7448:Dapk1 UTSW 13 60751176 missense probably damaging 1.00
R7480:Dapk1 UTSW 13 60757497 missense probably benign 0.18
R7532:Dapk1 UTSW 13 60730886 missense probably damaging 1.00
R7574:Dapk1 UTSW 13 60761173 missense probably damaging 1.00
R7711:Dapk1 UTSW 13 60761551 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGCAAGGACTTGATACTCTTG -3'
(R):5'- TCTGGTCTTGGCCACATGAG -3'

Sequencing Primer
(F):5'- CATAACTGTTCAGTATTCCATGGTG -3'
(R):5'- GGTGTTCCGGAAGAATTC -3'
Posted On2019-09-13