Incidental Mutation 'R7404:Hspa9'
ID 574470
Institutional Source Beutler Lab
Gene Symbol Hspa9
Ensembl Gene ENSMUSG00000024359
Gene Name heat shock protein 9
Synonyms C3H-specific antigen, mthsp70, GRP75, PBP74, CSA, Hsc74, mot-2, Hsp74a, Hspa9a, Hsp74, mortalin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock # R7404 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 34937414-34954357 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34943276 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 328 (N328D)
Ref Sequence ENSEMBL: ENSMUSP00000025217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025217]
AlphaFold P38647
Predicted Effect possibly damaging
Transcript: ENSMUST00000025217
AA Change: N328D

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025217
Gene: ENSMUSG00000024359
AA Change: N328D

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Pfam:HSP70 55 653 2.7e-270 PFAM
Pfam:FGGY_C 283 429 3e-8 PFAM
low complexity region 657 679 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (92/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heat shock protein 70 gene family. The encoded protein is primarily localized to the mitochondria but is also found in the endoplasmic reticulum, plasma membrane and cytoplasmic vesicles. This protein is a heat-shock cognate protein. This protein plays a role in cell proliferation, stress response and maintenance of the mitochondria. A pseudogene of this gene is found on chromosome 2.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality while heterozygotes display decreased pre-B cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
Ablim3 C T 18: 61,822,028 A297T probably damaging Het
Adprhl1 T A 8: 13,225,118 S547C probably damaging Het
Ankrd63 G C 2: 118,703,312 R43G unknown Het
Asah2 T C 19: 32,057,854 T24A probably benign Het
Asb17 G A 3: 153,844,810 probably null Het
Atp8b5 C T 4: 43,342,640 T437I probably benign Het
Bbs2 T C 8: 94,082,364 D311G probably damaging Het
Birc6 C T 17: 74,639,794 T2851I possibly damaging Het
Cchcr1 T C 17: 35,524,796 W266R probably benign Het
Col14a1 C A 15: 55,388,628 S560* probably null Het
Crocc G A 4: 141,026,186 T1317M possibly damaging Het
Cxxc1 T A 18: 74,219,207 V334E possibly damaging Het
Cyp3a25 T A 5: 145,986,825 D336V probably damaging Het
D430042O09Rik A T 7: 125,865,262 N1267I probably damaging Het
Dapk1 A G 13: 60,719,641 T221A probably benign Het
Dnah11 G T 12: 118,104,808 T1605K probably benign Het
Dnah7c T C 1: 46,666,063 V2412A possibly damaging Het
Ect2l T A 10: 18,159,781 D524V probably damaging Het
Ehbp1l1 T C 19: 5,720,844 E223G possibly damaging Het
Ephb2 A T 4: 136,771,213 M185K probably damaging Het
Fcer1a T C 1: 173,221,516 K243E probably damaging Het
Fcgbp T A 7: 28,101,507 I1326N probably damaging Het
Fgfr1 T C 8: 25,555,550 V45A probably benign Het
Filip1 T A 9: 79,820,098 E413V possibly damaging Het
Frs3 T C 17: 47,702,726 probably null Het
Fstl4 A G 11: 53,134,071 T257A probably benign Het
Gm15922 T C 7: 3,739,345 Y61C probably damaging Het
Golga5 A T 12: 102,484,519 K477M probably damaging Het
Gpr171 A T 3: 59,098,201 I51K probably damaging Het
H1f0 T A 15: 79,028,880 Y53* probably null Het
Hephl1 A G 9: 15,069,751 V795A possibly damaging Het
Hmcn1 A T 1: 150,720,759 D1775E probably benign Het
Hs3st2 A G 7: 121,500,945 D338G possibly damaging Het
Hsd3b6 T A 3: 98,806,218 Y255F probably benign Het
Hvcn1 T A 5: 122,237,685 I100N probably damaging Het
Ifi207 C T 1: 173,728,928 S748N possibly damaging Het
Kcnma1 G T 14: 24,002,834 T180K unknown Het
Kctd16 A G 18: 40,258,773 D138G probably damaging Het
Kifc3 A G 8: 95,103,464 Y605H probably benign Het
Kmt2d T A 15: 98,845,495 Q3928L unknown Het
Lamb2 C T 9: 108,487,583 R1179C probably damaging Het
Layn T A 9: 51,057,370 I358F possibly damaging Het
Lrig1 G A 6: 94,626,471 T232M probably damaging Het
Lrp1 T C 10: 127,582,708 T38A Het
Map3k14 A G 11: 103,239,092 V333A probably benign Het
Med13 T C 11: 86,286,446 D1608G possibly damaging Het
Mrps31 T G 8: 22,421,413 S224A probably benign Het
Msh6 G T 17: 87,975,120 Het
Ncapd3 A G 9: 27,067,019 D838G probably benign Het
Nlrp1a C A 11: 71,097,093 E1184* probably null Het
Npat T A 9: 53,554,933 probably null Het
Nup210 A T 6: 91,073,245 I414N probably benign Het
Olfr1097 A C 2: 86,890,873 L101V probably benign Het
Olfr1346 T C 7: 6,474,164 L18P probably damaging Het
Olfr1484 T A 19: 13,585,388 I28N possibly damaging Het
Olfr187 T C 16: 59,036,240 T166A possibly damaging Het
Olfr378 A T 11: 73,425,593 L130H probably damaging Het
Olfr666 A T 7: 104,892,974 V218E possibly damaging Het
Olfr876 A T 9: 37,803,961 T17S possibly damaging Het
Otud7b G C 3: 96,136,625 probably null Het
Phf11d A C 14: 59,359,493 W86G probably benign Het
Pik3c2b T A 1: 133,090,706 S964T probably damaging Het
Plod3 G A 5: 136,995,047 V687I probably benign Het
Poglut1 T G 16: 38,537,922 Y208S possibly damaging Het
Pou1f1 T A 16: 65,533,863 L253H probably damaging Het
Pou2f1 C T 1: 165,911,386 A166T unknown Het
Rhbdl3 C T 11: 80,346,833 S297L probably damaging Het
Rxra A T 2: 27,741,854 N179I probably damaging Het
Ryr2 C T 13: 11,735,620 E1922K probably damaging Het
Scube1 T C 15: 83,615,010 Y668C probably damaging Het
Sec16b A G 1: 157,531,357 Y120C probably damaging Het
Sec61b G T 4: 47,483,047 K92N probably damaging Het
Slc13a3 T C 2: 165,434,064 N254S possibly damaging Het
Slc17a7 T A 7: 45,172,930 Y397N probably benign Het
Slc25a3 A G 10: 91,117,040 V333A possibly damaging Het
Slc7a8 A T 14: 54,726,826 V390E probably damaging Het
Sorbs2 G A 8: 45,759,196 probably null Het
Srgap1 T C 10: 121,785,745 N948D probably benign Het
Tacc2 A T 7: 130,623,336 T584S probably benign Het
Tec A T 5: 72,763,618 D471E probably damaging Het
Tecpr2 C T 12: 110,931,604 A430V probably benign Het
Tmcc2 A T 1: 132,361,021 D309E probably damaging Het
Tmem82 G A 4: 141,617,431 A67V possibly damaging Het
Ttc23l T C 15: 10,551,577 Q21R probably damaging Het
Ttc37 T A 13: 76,148,747 Y1074* probably null Het
Ubl3 A G 5: 148,511,954 F26L probably damaging Het
Upf2 A G 2: 6,040,203 E1088G unknown Het
Usp9y T A Y: 1,341,780 I1362F probably benign Het
Wnk4 T A 11: 101,268,492 probably null Het
Wrn C G 8: 33,248,966 W1278S probably benign Het
Zfc3h1 T A 10: 115,415,248 V1248D probably damaging Het
Zfp12 T A 5: 143,240,344 V56D probably damaging Het
Other mutations in Hspa9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Hspa9 APN 18 34938580 splice site probably benign
IGL01939:Hspa9 APN 18 34938708 missense possibly damaging 0.89
IGL02008:Hspa9 APN 18 34947975 nonsense probably null
IGL02604:Hspa9 APN 18 34954213 missense unknown
Chiri-san UTSW 18 34939423 missense probably damaging 1.00
R0238:Hspa9 UTSW 18 34946646 nonsense probably null
R0238:Hspa9 UTSW 18 34946646 nonsense probably null
R0278:Hspa9 UTSW 18 34940910 missense possibly damaging 0.50
R0613:Hspa9 UTSW 18 34947980 missense probably damaging 1.00
R1414:Hspa9 UTSW 18 34938591 missense probably damaging 1.00
R1454:Hspa9 UTSW 18 34938606 missense probably damaging 1.00
R2013:Hspa9 UTSW 18 34946648 missense probably damaging 1.00
R2014:Hspa9 UTSW 18 34946648 missense probably damaging 1.00
R2015:Hspa9 UTSW 18 34946648 missense probably damaging 1.00
R2936:Hspa9 UTSW 18 34948014 missense probably damaging 1.00
R4261:Hspa9 UTSW 18 34939423 missense probably damaging 1.00
R4622:Hspa9 UTSW 18 34949037 missense possibly damaging 0.48
R4819:Hspa9 UTSW 18 34939388 missense probably damaging 0.98
R5056:Hspa9 UTSW 18 34938681 missense probably damaging 1.00
R5223:Hspa9 UTSW 18 34952671 splice site probably null
R5666:Hspa9 UTSW 18 34954247 missense probably null
R5820:Hspa9 UTSW 18 34943174 missense possibly damaging 0.82
R5944:Hspa9 UTSW 18 34949023 missense possibly damaging 0.94
R6460:Hspa9 UTSW 18 34952712 missense probably benign
R7412:Hspa9 UTSW 18 34949029 missense probably damaging 1.00
R7637:Hspa9 UTSW 18 34938687 missense not run
R8524:Hspa9 UTSW 18 34954244 missense unknown
R8830:Hspa9 UTSW 18 34948104 critical splice donor site probably null
R8987:Hspa9 UTSW 18 34947929 missense probably damaging 1.00
R9028:Hspa9 UTSW 18 34942031 missense probably damaging 1.00
R9184:Hspa9 UTSW 18 34949115 missense possibly damaging 0.87
Z1177:Hspa9 UTSW 18 34943145 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTTGTCATGCCACCAACCAG -3'
(R):5'- ACAGACTGAGTGCTGAGATTAGATATG -3'

Sequencing Primer
(F):5'- AACCAGAATCACTTCTCCTATGTC -3'
(R):5'- GTGCTTTTCAAGTCCGT -3'
Posted On 2019-09-13