Incidental Mutation 'R7405:Suco'
ID574483
Institutional Source Beutler Lab
Gene Symbol Suco
Ensembl Gene ENSMUSG00000040297
Gene NameSUN domain containing ossification factor
SynonymsAI848100, Opt, osteopotentia
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.677) question?
Stock #R7405 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location161816114-161876682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 161828214 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1039 (F1039L)
Ref Sequence ENSEMBL: ENSMUSP00000044815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048377]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048377
AA Change: F1039L

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044815
Gene: ENSMUSG00000040297
AA Change: F1039L

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 32 41 N/A INTRINSIC
low complexity region 117 145 N/A INTRINSIC
low complexity region 208 224 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
Pfam:Sad1_UNC 325 455 9e-43 PFAM
low complexity region 665 683 N/A INTRINSIC
low complexity region 745 758 N/A INTRINSIC
coiled coil region 933 1009 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
low complexity region 1105 1119 N/A INTRINSIC
low complexity region 1163 1176 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a mutation in this gene display background strain-dependent neonatal and postnatal lethality, and impaired osteoblast differentiation resulting in impaired bone formation, brittle bones, and impaired fracture repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G T 17: 9,001,817 V383L probably damaging Het
1700012P22Rik T C 4: 144,419,753 N110S probably damaging Het
2410141K09Rik T C 13: 66,431,059 Q455R unknown Het
4930507D05Rik C A 10: 62,449,784 H96N unknown Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
5730480H06Rik T C 5: 48,388,116 I235T possibly damaging Het
Abcb11 A G 2: 69,287,619 Y472H probably damaging Het
Adam39 A T 8: 40,824,622 I17L probably benign Het
Aire T C 10: 78,034,613 H458R probably benign Het
Ap3d1 T C 10: 80,741,900 D31G probably benign Het
Atad2b T A 12: 4,943,232 H250Q probably benign Het
Borcs5 C A 6: 134,685,982 T74N probably benign Het
Btbd16 C T 7: 130,805,856 T292I probably benign Het
Catsperd G A 17: 56,632,335 V55M possibly damaging Het
Ctr9 T C 7: 111,043,714 F462S possibly damaging Het
Cyp4f39 A G 17: 32,481,815 S153G probably benign Het
Ddo T C 10: 40,647,997 C328R possibly damaging Het
Ddr1 A G 17: 35,690,100 V251A probably damaging Het
Dis3l A G 9: 64,314,704 F475L probably damaging Het
Dkk4 G A 8: 22,625,843 V99M probably benign Het
Dync1h1 C T 12: 110,634,220 A1938V probably damaging Het
Ecel1 A T 1: 87,153,516 probably null Het
Fbxo7 T A 10: 86,044,581 Y377N probably damaging Het
Fbxw24 T C 9: 109,607,068 I299V possibly damaging Het
Fkbp10 C T 11: 100,415,881 A33V probably damaging Het
Gabra1 T C 11: 42,155,023 T87A probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm884 A T 11: 103,615,161 Y1994N probably benign Het
Golga3 A T 5: 110,208,446 I1000F probably damaging Het
Grid2ip T C 5: 143,380,444 I563T probably benign Het
Gsx1 T C 5: 147,189,133 S82P possibly damaging Het
Heg1 A G 16: 33,763,449 K34E possibly damaging Het
Kank1 T A 19: 25,410,319 L452* probably null Het
Lce1k A T 3: 92,806,874 M1K probably null Het
Lcmt2 A G 2: 121,139,387 I185T probably benign Het
Lrp1 T C 10: 127,581,751 D1046G possibly damaging Het
Mast3 A T 8: 70,786,171 D496E probably damaging Het
Mst1r C T 9: 107,915,122 S925F possibly damaging Het
Mterf2 C T 10: 85,120,496 G88D probably damaging Het
Mthfd1 T C 12: 76,311,874 V783A probably damaging Het
Mybpc2 A T 7: 44,507,194 W778R probably damaging Het
Nbea A G 3: 55,805,266 L2130P possibly damaging Het
Ndst4 A G 3: 125,683,216 N30S probably benign Het
Nphs1 T C 7: 30,462,828 V299A possibly damaging Het
Nup107 T C 10: 117,770,415 D474G probably benign Het
Olfr1118 A C 2: 87,308,995 I89L probably benign Het
Olfr1490 T C 19: 13,654,882 V151A probably benign Het
Olfr225 T A 11: 59,614,073 F370I possibly damaging Het
Olfr8 T C 10: 78,955,697 V164A probably benign Het
Pgap2 T C 7: 102,231,388 V41A probably benign Het
Plekhh1 C T 12: 79,055,047 T297I probably benign Het
Plxna4 A T 6: 32,196,319 Y1226N probably benign Het
Polr3b A G 10: 84,684,179 D653G probably benign Het
Ppp2r2c T C 5: 36,947,142 F289L possibly damaging Het
Prickle2 A G 6: 92,458,543 S82P probably damaging Het
Ptger2 T A 14: 44,989,074 V37D probably damaging Het
Rasa2 G A 9: 96,566,027 P526S probably benign Het
Rbm47 A T 5: 66,026,495 I255N probably damaging Het
Sez6 A T 11: 77,962,891 T296S probably benign Het
Slc2a9 T A 5: 38,391,824 I316F probably damaging Het
Slc41a1 T A 1: 131,839,146 V134D probably damaging Het
Slc5a7 A T 17: 54,297,133 S2T probably benign Het
Slc9a4 C T 1: 40,600,926 R293C probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Sycp1 A G 3: 102,925,227 Y208H possibly damaging Het
Tpr T C 1: 150,442,127 S2129P probably benign Het
Trim34b T A 7: 104,336,483 S442T probably damaging Het
Ttn A T 2: 76,743,346 Y25734* probably null Het
Uchl5 C T 1: 143,800,014 Q276* probably null Het
Wrn C G 8: 33,248,966 W1278S probably benign Het
Yeats2 T A 16: 20,222,913 D1184E probably damaging Het
Zfat G A 15: 68,184,485 R241W probably damaging Het
Zfp646 T A 7: 127,878,796 Y48* probably null Het
Other mutations in Suco
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Suco APN 1 161834120 missense probably damaging 1.00
IGL01688:Suco APN 1 161863911 splice site probably null
IGL01794:Suco APN 1 161827725 missense probably benign 0.01
IGL01891:Suco APN 1 161838802 missense probably damaging 1.00
IGL02028:Suco APN 1 161856859 missense possibly damaging 0.95
IGL02102:Suco APN 1 161827705 missense probably damaging 1.00
IGL02351:Suco APN 1 161818626 missense probably benign 0.35
IGL02358:Suco APN 1 161818626 missense probably benign 0.35
IGL02392:Suco APN 1 161834567 missense probably benign 0.11
IGL02638:Suco APN 1 161827687 missense probably damaging 1.00
IGL02650:Suco APN 1 161848753 splice site probably benign
IGL03106:Suco APN 1 161834480 missense possibly damaging 0.91
IGL03189:Suco APN 1 161857337 unclassified probably benign
IGL03328:Suco APN 1 161820421 missense probably damaging 0.99
girth UTSW 1 161828240 missense possibly damaging 0.86
pleasingly UTSW 1 161834408 missense possibly damaging 0.65
3-1:Suco UTSW 1 161822031 intron probably benign
H8562:Suco UTSW 1 161852851 missense probably damaging 1.00
H8786:Suco UTSW 1 161852851 missense probably damaging 1.00
R0023:Suco UTSW 1 161845585 splice site probably null
R0023:Suco UTSW 1 161845585 splice site probably null
R0179:Suco UTSW 1 161876305 splice site probably benign
R0299:Suco UTSW 1 161853810 missense probably benign
R0418:Suco UTSW 1 161834850 missense probably benign 0.11
R0481:Suco UTSW 1 161862313 unclassified probably benign
R0610:Suco UTSW 1 161859503 missense probably benign
R0610:Suco UTSW 1 161864032 splice site probably benign
R0634:Suco UTSW 1 161838804 missense possibly damaging 0.77
R0645:Suco UTSW 1 161834114 missense probably damaging 1.00
R1276:Suco UTSW 1 161857456 missense probably benign 0.10
R1720:Suco UTSW 1 161834054 missense probably damaging 1.00
R1739:Suco UTSW 1 161827655 critical splice donor site probably null
R1763:Suco UTSW 1 161834949 missense possibly damaging 0.80
R1835:Suco UTSW 1 161859500 nonsense probably null
R1988:Suco UTSW 1 161818811 critical splice acceptor site probably null
R2939:Suco UTSW 1 161848651 missense probably damaging 1.00
R3773:Suco UTSW 1 161843996 splice site probably null
R3882:Suco UTSW 1 161834744 missense probably benign 0.33
R4193:Suco UTSW 1 161863959 missense probably benign 0.32
R4367:Suco UTSW 1 161847230 missense probably damaging 1.00
R4397:Suco UTSW 1 161844852 missense probably damaging 1.00
R4846:Suco UTSW 1 161834408 missense possibly damaging 0.65
R4851:Suco UTSW 1 161834192 missense probably damaging 1.00
R5224:Suco UTSW 1 161834705 missense probably benign 0.06
R5329:Suco UTSW 1 161833430 missense probably damaging 0.99
R6133:Suco UTSW 1 161835183 nonsense probably null
R6632:Suco UTSW 1 161828240 missense possibly damaging 0.86
R6643:Suco UTSW 1 161859432 missense possibly damaging 0.71
R7378:Suco UTSW 1 161862211 missense possibly damaging 0.76
R7509:Suco UTSW 1 161845334 missense probably damaging 1.00
R7838:Suco UTSW 1 161829321 missense probably benign 0.07
R7867:Suco UTSW 1 161837796 missense possibly damaging 0.77
R7895:Suco UTSW 1 161845368 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTACAGTTACCATCTTGCTACAATG -3'
(R):5'- AGTTTGTTTTCAAGCACCATGC -3'

Sequencing Primer
(F):5'- CTGCTCAGCATTTCTTTGAG -3'
(R):5'- TGATTTCAGAGCACCTTGACTG -3'
Posted On2019-09-13