Incidental Mutation 'R7405:Lcmt2'
ID574487
Institutional Source Beutler Lab
Gene Symbol Lcmt2
Ensembl Gene ENSMUSG00000074890
Gene Nameleucine carboxyl methyltransferase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R7405 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location121128307-121140653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121139387 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 185 (I185T)
Ref Sequence ENSEMBL: ENSMUSP00000097085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028702] [ENSMUST00000066155] [ENSMUST00000099486] [ENSMUST00000110662] [ENSMUST00000110665] [ENSMUST00000110674] [ENSMUST00000119031]
Predicted Effect probably benign
Transcript: ENSMUST00000028702
SMART Domains Protein: ENSMUSP00000028702
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 1 276 1.8e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066155
SMART Domains Protein: ENSMUSP00000067133
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 16 343 1.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099486
AA Change: I185T

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097085
Gene: ENSMUSG00000074890
AA Change: I185T

DomainStartEndE-ValueType
PDB:3P71|T 4 94 6e-12 PDB
SCOP:d1k3ia3 137 401 2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110662
SMART Domains Protein: ENSMUSP00000106290
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 2 200 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110665
SMART Domains Protein: ENSMUSP00000106293
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 2 236 4.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110674
AA Change: I405T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106302
Gene: ENSMUSG00000074890
AA Change: I405T

DomainStartEndE-ValueType
Pfam:LCM 12 207 5.4e-28 PFAM
Pfam:Kelch_3 492 542 2.2e-6 PFAM
low complexity region 544 563 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119031
SMART Domains Protein: ENSMUSP00000113052
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 16 343 3e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this intronless gene belongs to the highly variable methyltransferase superfamily. This gene is the inferred homolog of the Saccharomyces cerevisiae carboxymethyltransferase gene PPM2 that is essential for the synthesis of the hypermodified guanosine Wybutosine (yW). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G T 17: 9,001,817 V383L probably damaging Het
1700012P22Rik T C 4: 144,419,753 N110S probably damaging Het
2410141K09Rik T C 13: 66,431,059 Q455R unknown Het
4930507D05Rik C A 10: 62,449,784 H96N unknown Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
5730480H06Rik T C 5: 48,388,116 I235T possibly damaging Het
Abcb11 A G 2: 69,287,619 Y472H probably damaging Het
Adam39 A T 8: 40,824,622 I17L probably benign Het
Aire T C 10: 78,034,613 H458R probably benign Het
Ap3d1 T C 10: 80,741,900 D31G probably benign Het
Atad2b T A 12: 4,943,232 H250Q probably benign Het
Borcs5 C A 6: 134,685,982 T74N probably benign Het
Btbd16 C T 7: 130,805,856 T292I probably benign Het
Catsperd G A 17: 56,632,335 V55M possibly damaging Het
Ctr9 T C 7: 111,043,714 F462S possibly damaging Het
Cyp4f39 A G 17: 32,481,815 S153G probably benign Het
Ddo T C 10: 40,647,997 C328R possibly damaging Het
Ddr1 A G 17: 35,690,100 V251A probably damaging Het
Dis3l A G 9: 64,314,704 F475L probably damaging Het
Dkk4 G A 8: 22,625,843 V99M probably benign Het
Dync1h1 C T 12: 110,634,220 A1938V probably damaging Het
Ecel1 A T 1: 87,153,516 probably null Het
Fbxo7 T A 10: 86,044,581 Y377N probably damaging Het
Fbxw24 T C 9: 109,607,068 I299V possibly damaging Het
Fkbp10 C T 11: 100,415,881 A33V probably damaging Het
Gabra1 T C 11: 42,155,023 T87A probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm884 A T 11: 103,615,161 Y1994N probably benign Het
Golga3 A T 5: 110,208,446 I1000F probably damaging Het
Grid2ip T C 5: 143,380,444 I563T probably benign Het
Gsx1 T C 5: 147,189,133 S82P possibly damaging Het
Heg1 A G 16: 33,763,449 K34E possibly damaging Het
Kank1 T A 19: 25,410,319 L452* probably null Het
Lce1k A T 3: 92,806,874 M1K probably null Het
Lrp1 T C 10: 127,581,751 D1046G possibly damaging Het
Mast3 A T 8: 70,786,171 D496E probably damaging Het
Mst1r C T 9: 107,915,122 S925F possibly damaging Het
Mterf2 C T 10: 85,120,496 G88D probably damaging Het
Mthfd1 T C 12: 76,311,874 V783A probably damaging Het
Mybpc2 A T 7: 44,507,194 W778R probably damaging Het
Nbea A G 3: 55,805,266 L2130P possibly damaging Het
Ndst4 A G 3: 125,683,216 N30S probably benign Het
Nphs1 T C 7: 30,462,828 V299A possibly damaging Het
Nup107 T C 10: 117,770,415 D474G probably benign Het
Olfr1118 A C 2: 87,308,995 I89L probably benign Het
Olfr1490 T C 19: 13,654,882 V151A probably benign Het
Olfr225 T A 11: 59,614,073 F370I possibly damaging Het
Olfr8 T C 10: 78,955,697 V164A probably benign Het
Pgap2 T C 7: 102,231,388 V41A probably benign Het
Plekhh1 C T 12: 79,055,047 T297I probably benign Het
Plxna4 A T 6: 32,196,319 Y1226N probably benign Het
Polr3b A G 10: 84,684,179 D653G probably benign Het
Ppp2r2c T C 5: 36,947,142 F289L possibly damaging Het
Prickle2 A G 6: 92,458,543 S82P probably damaging Het
Ptger2 T A 14: 44,989,074 V37D probably damaging Het
Rasa2 G A 9: 96,566,027 P526S probably benign Het
Rbm47 A T 5: 66,026,495 I255N probably damaging Het
Sez6 A T 11: 77,962,891 T296S probably benign Het
Slc2a9 T A 5: 38,391,824 I316F probably damaging Het
Slc41a1 T A 1: 131,839,146 V134D probably damaging Het
Slc5a7 A T 17: 54,297,133 S2T probably benign Het
Slc9a4 C T 1: 40,600,926 R293C probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Suco A G 1: 161,828,214 F1039L possibly damaging Het
Sycp1 A G 3: 102,925,227 Y208H possibly damaging Het
Tpr T C 1: 150,442,127 S2129P probably benign Het
Trim34b T A 7: 104,336,483 S442T probably damaging Het
Ttn A T 2: 76,743,346 Y25734* probably null Het
Uchl5 C T 1: 143,800,014 Q276* probably null Het
Wrn C G 8: 33,248,966 W1278S probably benign Het
Yeats2 T A 16: 20,222,913 D1184E probably damaging Het
Zfat G A 15: 68,184,485 R241W probably damaging Het
Zfp646 T A 7: 127,878,796 Y48* probably null Het
Other mutations in Lcmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Lcmt2 APN 2 121138913 missense possibly damaging 0.94
R0352:Lcmt2 UTSW 2 121138896 missense probably benign 0.06
R0519:Lcmt2 UTSW 2 121139344 unclassified probably null
R0685:Lcmt2 UTSW 2 121139240 missense probably benign 0.14
R1437:Lcmt2 UTSW 2 121138896 missense probably benign 0.06
R1500:Lcmt2 UTSW 2 121140007 missense probably benign 0.00
R1569:Lcmt2 UTSW 2 121139828 missense probably damaging 1.00
R1612:Lcmt2 UTSW 2 121139120 missense probably damaging 1.00
R1618:Lcmt2 UTSW 2 121138652 missense probably damaging 0.98
R1990:Lcmt2 UTSW 2 121140281 missense probably benign 0.07
R2091:Lcmt2 UTSW 2 121138616 missense probably damaging 1.00
R2159:Lcmt2 UTSW 2 121139285 missense probably damaging 1.00
R3812:Lcmt2 UTSW 2 121138706 missense probably benign 0.01
R4725:Lcmt2 UTSW 2 121139430 missense probably benign 0.00
R4727:Lcmt2 UTSW 2 121139430 missense probably benign 0.00
R4968:Lcmt2 UTSW 2 121139736 missense probably benign 0.00
R5626:Lcmt2 UTSW 2 121139462 missense probably benign
R6246:Lcmt2 UTSW 2 121140389 missense probably damaging 1.00
R6326:Lcmt2 UTSW 2 121139457 nonsense probably null
R6524:Lcmt2 UTSW 2 121138931 missense possibly damaging 0.75
R6924:Lcmt2 UTSW 2 121140003 missense probably benign
R7282:Lcmt2 UTSW 2 121138790 missense probably damaging 1.00
R7408:Lcmt2 UTSW 2 121138704 missense probably benign 0.08
R8062:Lcmt2 UTSW 2 121140272 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CAAGGCAGCCTTCGTTACTG -3'
(R):5'- CAGGGTTTCTTTCTGCCAGAG -3'

Sequencing Primer
(F):5'- ACTGTTACATTTTGGCCCTCAGAG -3'
(R):5'- CTGCCAGAGTAGTCACTAGTG -3'
Posted On2019-09-13