Incidental Mutation 'R7405:Golga3'
ID 574497
Institutional Source Beutler Lab
Gene Symbol Golga3
Ensembl Gene ENSMUSG00000029502
Gene Name golgi autoantigen, golgin subfamily a, 3
Synonyms repro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2
MMRRC Submission 045376-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7405 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 110176701-110226470 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 110208446 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1000 (I1000F)
Ref Sequence ENSEMBL: ENSMUSP00000108131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000031477
AA Change: I1040F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502
AA Change: I1040F

DomainStartEndE-ValueType
internal_repeat_1 24 49 7.67e-5 PROSPERO
internal_repeat_1 91 116 7.67e-5 PROSPERO
low complexity region 232 245 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 312 321 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 422 441 N/A INTRINSIC
internal_repeat_2 444 484 7.67e-5 PROSPERO
low complexity region 534 548 N/A INTRINSIC
internal_repeat_2 587 624 7.67e-5 PROSPERO
coiled coil region 656 1379 N/A INTRINSIC
coiled coil region 1417 1453 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112512
AA Change: I1000F

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502
AA Change: I1000F

DomainStartEndE-ValueType
internal_repeat_2 3 24 9.29e-5 PROSPERO
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 248 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 382 401 N/A INTRINSIC
internal_repeat_1 404 444 4.91e-5 PROSPERO
low complexity region 494 508 N/A INTRINSIC
internal_repeat_1 547 584 4.91e-5 PROSPERO
low complexity region 705 717 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
low complexity region 1105 1117 N/A INTRINSIC
low complexity region 1220 1228 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
internal_repeat_2 1333 1359 9.29e-5 PROSPERO
coiled coil region 1377 1413 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G T 17: 9,001,817 (GRCm38) V383L probably damaging Het
1700012P22Rik T C 4: 144,419,753 (GRCm38) N110S probably damaging Het
2410141K09Rik T C 13: 66,431,059 (GRCm38) Q455R unknown Het
4930507D05Rik C A 10: 62,449,784 (GRCm38) H96N unknown Het
4930539E08Rik G A 17: 28,905,324 (GRCm38) R335W probably damaging Het
5730480H06Rik T C 5: 48,388,116 (GRCm38) I235T possibly damaging Het
Abcb11 A G 2: 69,287,619 (GRCm38) Y472H probably damaging Het
Adam39 A T 8: 40,824,622 (GRCm38) I17L probably benign Het
Aire T C 10: 78,034,613 (GRCm38) H458R probably benign Het
Ap3d1 T C 10: 80,741,900 (GRCm38) D31G probably benign Het
Atad2b T A 12: 4,943,232 (GRCm38) H250Q probably benign Het
Borcs5 C A 6: 134,685,982 (GRCm38) T74N probably benign Het
Btbd16 C T 7: 130,805,856 (GRCm38) T292I probably benign Het
Catsperd G A 17: 56,632,335 (GRCm38) V55M possibly damaging Het
Ctr9 T C 7: 111,043,714 (GRCm38) F462S possibly damaging Het
Cyp4f39 A G 17: 32,481,815 (GRCm38) S153G probably benign Het
Ddo T C 10: 40,647,997 (GRCm38) C328R possibly damaging Het
Ddr1 A G 17: 35,690,100 (GRCm38) V251A probably damaging Het
Dis3l A G 9: 64,314,704 (GRCm38) F475L probably damaging Het
Dkk4 G A 8: 22,625,843 (GRCm38) V99M probably benign Het
Dync1h1 C T 12: 110,634,220 (GRCm38) A1938V probably damaging Het
Ecel1 A T 1: 87,153,516 (GRCm38) probably null Het
Fbxo7 T A 10: 86,044,581 (GRCm38) Y377N probably damaging Het
Fbxw24 T C 9: 109,607,068 (GRCm38) I299V possibly damaging Het
Fkbp10 C T 11: 100,415,881 (GRCm38) A33V probably damaging Het
Gabra1 T C 11: 42,155,023 (GRCm38) T87A probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 (GRCm38) probably benign Het
Gm884 A T 11: 103,615,161 (GRCm38) Y1994N probably benign Het
Grid2ip T C 5: 143,380,444 (GRCm38) I563T probably benign Het
Gsx1 T C 5: 147,189,133 (GRCm38) S82P possibly damaging Het
Heg1 A G 16: 33,763,449 (GRCm38) K34E possibly damaging Het
Kank1 T A 19: 25,410,319 (GRCm38) L452* probably null Het
Lce1k A T 3: 92,806,874 (GRCm38) M1K probably null Het
Lcmt2 A G 2: 121,139,387 (GRCm38) I185T probably benign Het
Lrp1 T C 10: 127,581,751 (GRCm38) D1046G possibly damaging Het
Mast3 A T 8: 70,786,171 (GRCm38) D496E probably damaging Het
Mst1r C T 9: 107,915,122 (GRCm38) S925F possibly damaging Het
Mterf2 C T 10: 85,120,496 (GRCm38) G88D probably damaging Het
Mthfd1 T C 12: 76,311,874 (GRCm38) V783A probably damaging Het
Mybpc2 A T 7: 44,507,194 (GRCm38) W778R probably damaging Het
Nbea A G 3: 55,805,266 (GRCm38) L2130P possibly damaging Het
Ndst4 A G 3: 125,683,216 (GRCm38) N30S probably benign Het
Nphs1 T C 7: 30,462,828 (GRCm38) V299A possibly damaging Het
Nup107 T C 10: 117,770,415 (GRCm38) D474G probably benign Het
Olfr1118 A C 2: 87,308,995 (GRCm38) I89L probably benign Het
Olfr1490 T C 19: 13,654,882 (GRCm38) V151A probably benign Het
Olfr225 T A 11: 59,614,073 (GRCm38) F370I possibly damaging Het
Olfr8 T C 10: 78,955,697 (GRCm38) V164A probably benign Het
Pgap2 T C 7: 102,231,388 (GRCm38) V41A probably benign Het
Plekhh1 C T 12: 79,055,047 (GRCm38) T297I probably benign Het
Plxna4 A T 6: 32,196,319 (GRCm38) Y1226N probably benign Het
Polr3b A G 10: 84,684,179 (GRCm38) D653G probably benign Het
Ppp2r2c T C 5: 36,947,142 (GRCm38) F289L possibly damaging Het
Prickle2 A G 6: 92,458,543 (GRCm38) S82P probably damaging Het
Ptger2 T A 14: 44,989,074 (GRCm38) V37D probably damaging Het
Rasa2 G A 9: 96,566,027 (GRCm38) P526S probably benign Het
Rbm47 A T 5: 66,026,495 (GRCm38) I255N probably damaging Het
Sez6 A T 11: 77,962,891 (GRCm38) T296S probably benign Het
Slc2a9 T A 5: 38,391,824 (GRCm38) I316F probably damaging Het
Slc41a1 T A 1: 131,839,146 (GRCm38) V134D probably damaging Het
Slc5a7 A T 17: 54,297,133 (GRCm38) S2T probably benign Het
Slc9a4 C T 1: 40,600,926 (GRCm38) R293C probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 (GRCm38) probably benign Het
Suco A G 1: 161,828,214 (GRCm38) F1039L possibly damaging Het
Sycp1 A G 3: 102,925,227 (GRCm38) Y208H possibly damaging Het
Tpr T C 1: 150,442,127 (GRCm38) S2129P probably benign Het
Trim34b T A 7: 104,336,483 (GRCm38) S442T probably damaging Het
Ttn A T 2: 76,743,346 (GRCm38) Y25734* probably null Het
Uchl5 C T 1: 143,800,014 (GRCm38) Q276* probably null Het
Wrn C G 8: 33,248,966 (GRCm38) W1278S probably benign Het
Yeats2 T A 16: 20,222,913 (GRCm38) D1184E probably damaging Het
Zfat G A 15: 68,184,485 (GRCm38) R241W probably damaging Het
Zfp646 T A 7: 127,878,796 (GRCm38) Y48* probably null Het
Other mutations in Golga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Golga3 APN 5 110,220,887 (GRCm38) missense probably damaging 1.00
IGL00594:Golga3 APN 5 110,204,975 (GRCm38) missense probably benign 0.37
IGL00672:Golga3 APN 5 110,212,244 (GRCm38) missense probably damaging 1.00
IGL00821:Golga3 APN 5 110,204,933 (GRCm38) missense possibly damaging 0.74
IGL01015:Golga3 APN 5 110,187,717 (GRCm38) missense probably benign 0.04
IGL01408:Golga3 APN 5 110,217,809 (GRCm38) critical splice acceptor site probably null
IGL01651:Golga3 APN 5 110,192,905 (GRCm38) critical splice acceptor site probably null
IGL02617:Golga3 APN 5 110,188,746 (GRCm38) missense probably benign 0.26
cles UTSW 5 110,188,707 (GRCm38) nonsense probably null
tenta UTSW 5 110,218,130 (GRCm38) nonsense probably null
PIT4544001:Golga3 UTSW 5 110,188,690 (GRCm38) missense possibly damaging 0.94
R0058:Golga3 UTSW 5 110,202,777 (GRCm38) missense possibly damaging 0.85
R0058:Golga3 UTSW 5 110,202,777 (GRCm38) missense possibly damaging 0.85
R0591:Golga3 UTSW 5 110,188,743 (GRCm38) missense probably damaging 1.00
R1219:Golga3 UTSW 5 110,184,349 (GRCm38) nonsense probably null
R1297:Golga3 UTSW 5 110,204,843 (GRCm38) missense probably benign 0.04
R1299:Golga3 UTSW 5 110,204,843 (GRCm38) missense probably benign 0.04
R1465:Golga3 UTSW 5 110,209,878 (GRCm38) missense probably damaging 1.00
R1465:Golga3 UTSW 5 110,209,878 (GRCm38) missense probably damaging 1.00
R1589:Golga3 UTSW 5 110,181,783 (GRCm38) missense probably damaging 1.00
R1795:Golga3 UTSW 5 110,207,627 (GRCm38) missense possibly damaging 0.47
R1992:Golga3 UTSW 5 110,192,973 (GRCm38) missense probably damaging 0.96
R2116:Golga3 UTSW 5 110,187,395 (GRCm38) missense probably damaging 0.97
R2130:Golga3 UTSW 5 110,202,939 (GRCm38) critical splice donor site probably null
R2153:Golga3 UTSW 5 110,187,990 (GRCm38) splice site probably null
R2158:Golga3 UTSW 5 110,187,361 (GRCm38) missense probably damaging 1.00
R2357:Golga3 UTSW 5 110,202,648 (GRCm38) missense probably damaging 1.00
R2397:Golga3 UTSW 5 110,205,877 (GRCm38) splice site probably benign
R2418:Golga3 UTSW 5 110,201,868 (GRCm38) missense probably damaging 1.00
R2495:Golga3 UTSW 5 110,207,596 (GRCm38) missense probably damaging 0.99
R2763:Golga3 UTSW 5 110,204,895 (GRCm38) missense possibly damaging 0.87
R3276:Golga3 UTSW 5 110,201,998 (GRCm38) splice site probably benign
R3614:Golga3 UTSW 5 110,220,908 (GRCm38) missense probably damaging 1.00
R4520:Golga3 UTSW 5 110,203,751 (GRCm38) nonsense probably null
R5001:Golga3 UTSW 5 110,205,777 (GRCm38) missense probably damaging 1.00
R5046:Golga3 UTSW 5 110,192,940 (GRCm38) missense probably damaging 0.99
R5157:Golga3 UTSW 5 110,202,671 (GRCm38) missense probably benign 0.00
R5191:Golga3 UTSW 5 110,184,307 (GRCm38) intron probably benign
R5376:Golga3 UTSW 5 110,220,945 (GRCm38) critical splice donor site probably null
R5399:Golga3 UTSW 5 110,205,024 (GRCm38) missense probably damaging 0.96
R5407:Golga3 UTSW 5 110,201,990 (GRCm38) nonsense probably null
R5884:Golga3 UTSW 5 110,216,895 (GRCm38) missense probably damaging 1.00
R6087:Golga3 UTSW 5 110,204,946 (GRCm38) missense probably damaging 0.99
R6526:Golga3 UTSW 5 110,204,895 (GRCm38) missense probably damaging 0.98
R6651:Golga3 UTSW 5 110,218,130 (GRCm38) nonsense probably null
R7041:Golga3 UTSW 5 110,208,584 (GRCm38) critical splice donor site probably null
R7057:Golga3 UTSW 5 110,188,663 (GRCm38) missense probably damaging 1.00
R7078:Golga3 UTSW 5 110,193,087 (GRCm38) missense probably damaging 0.99
R7114:Golga3 UTSW 5 110,202,712 (GRCm38) missense probably benign 0.01
R7190:Golga3 UTSW 5 110,209,855 (GRCm38) missense probably damaging 1.00
R7528:Golga3 UTSW 5 110,212,232 (GRCm38) missense probably damaging 1.00
R7638:Golga3 UTSW 5 110,205,828 (GRCm38) missense probably benign
R7760:Golga3 UTSW 5 110,205,850 (GRCm38) missense probably benign 0.39
R8099:Golga3 UTSW 5 110,188,707 (GRCm38) nonsense probably null
R8144:Golga3 UTSW 5 110,185,879 (GRCm38) missense probably damaging 0.99
R8558:Golga3 UTSW 5 110,208,555 (GRCm38) missense possibly damaging 0.83
R8708:Golga3 UTSW 5 110,202,855 (GRCm38) missense probably benign 0.05
R8887:Golga3 UTSW 5 110,205,760 (GRCm38) intron probably benign
R9039:Golga3 UTSW 5 110,204,933 (GRCm38) missense probably benign 0.00
R9045:Golga3 UTSW 5 110,193,097 (GRCm38) missense probably benign 0.00
R9057:Golga3 UTSW 5 110,184,599 (GRCm38) missense probably damaging 1.00
R9100:Golga3 UTSW 5 110,189,678 (GRCm38) missense probably benign 0.31
R9112:Golga3 UTSW 5 110,185,891 (GRCm38) missense probably benign 0.08
R9198:Golga3 UTSW 5 110,207,753 (GRCm38) missense probably benign 0.11
R9755:Golga3 UTSW 5 110,192,981 (GRCm38) missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- AGCCTTCTGAGTTGGGTTTAGTAA -3'
(R):5'- GGAGCAAAGCACAGCCACT -3'

Sequencing Primer
(F):5'- ACCATGCCTGATGACTTGAG -3'
(R):5'- AGCCACTCTGTTTTTAGCAATGCAG -3'
Posted On 2019-09-13