Incidental Mutation 'R7405:Golga3'
ID574497
Institutional Source Beutler Lab
Gene Symbol Golga3
Ensembl Gene ENSMUSG00000029502
Gene Namegolgi autoantigen, golgin subfamily a, 3
Synonymsrepro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7405 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location110176701-110226470 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110208446 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1000 (I1000F)
Ref Sequence ENSEMBL: ENSMUSP00000108131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512]
Predicted Effect probably damaging
Transcript: ENSMUST00000031477
AA Change: I1040F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502
AA Change: I1040F

DomainStartEndE-ValueType
internal_repeat_1 24 49 7.67e-5 PROSPERO
internal_repeat_1 91 116 7.67e-5 PROSPERO
low complexity region 232 245 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 312 321 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 422 441 N/A INTRINSIC
internal_repeat_2 444 484 7.67e-5 PROSPERO
low complexity region 534 548 N/A INTRINSIC
internal_repeat_2 587 624 7.67e-5 PROSPERO
coiled coil region 656 1379 N/A INTRINSIC
coiled coil region 1417 1453 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112512
AA Change: I1000F

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502
AA Change: I1000F

DomainStartEndE-ValueType
internal_repeat_2 3 24 9.29e-5 PROSPERO
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 248 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 382 401 N/A INTRINSIC
internal_repeat_1 404 444 4.91e-5 PROSPERO
low complexity region 494 508 N/A INTRINSIC
internal_repeat_1 547 584 4.91e-5 PROSPERO
low complexity region 705 717 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
low complexity region 1105 1117 N/A INTRINSIC
low complexity region 1220 1228 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
internal_repeat_2 1333 1359 9.29e-5 PROSPERO
coiled coil region 1377 1413 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G T 17: 9,001,817 V383L probably damaging Het
1700012P22Rik T C 4: 144,419,753 N110S probably damaging Het
2410141K09Rik T C 13: 66,431,059 Q455R unknown Het
4930507D05Rik C A 10: 62,449,784 H96N unknown Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
5730480H06Rik T C 5: 48,388,116 I235T possibly damaging Het
Abcb11 A G 2: 69,287,619 Y472H probably damaging Het
Adam39 A T 8: 40,824,622 I17L probably benign Het
Aire T C 10: 78,034,613 H458R probably benign Het
Ap3d1 T C 10: 80,741,900 D31G probably benign Het
Atad2b T A 12: 4,943,232 H250Q probably benign Het
Borcs5 C A 6: 134,685,982 T74N probably benign Het
Btbd16 C T 7: 130,805,856 T292I probably benign Het
Catsperd G A 17: 56,632,335 V55M possibly damaging Het
Ctr9 T C 7: 111,043,714 F462S possibly damaging Het
Cyp4f39 A G 17: 32,481,815 S153G probably benign Het
Ddo T C 10: 40,647,997 C328R possibly damaging Het
Ddr1 A G 17: 35,690,100 V251A probably damaging Het
Dis3l A G 9: 64,314,704 F475L probably damaging Het
Dkk4 G A 8: 22,625,843 V99M probably benign Het
Dync1h1 C T 12: 110,634,220 A1938V probably damaging Het
Ecel1 A T 1: 87,153,516 probably null Het
Fbxo7 T A 10: 86,044,581 Y377N probably damaging Het
Fbxw24 T C 9: 109,607,068 I299V possibly damaging Het
Fkbp10 C T 11: 100,415,881 A33V probably damaging Het
Gabra1 T C 11: 42,155,023 T87A probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm884 A T 11: 103,615,161 Y1994N probably benign Het
Grid2ip T C 5: 143,380,444 I563T probably benign Het
Gsx1 T C 5: 147,189,133 S82P possibly damaging Het
Heg1 A G 16: 33,763,449 K34E possibly damaging Het
Kank1 T A 19: 25,410,319 L452* probably null Het
Lce1k A T 3: 92,806,874 M1K probably null Het
Lcmt2 A G 2: 121,139,387 I185T probably benign Het
Lrp1 T C 10: 127,581,751 D1046G possibly damaging Het
Mast3 A T 8: 70,786,171 D496E probably damaging Het
Mst1r C T 9: 107,915,122 S925F possibly damaging Het
Mterf2 C T 10: 85,120,496 G88D probably damaging Het
Mthfd1 T C 12: 76,311,874 V783A probably damaging Het
Mybpc2 A T 7: 44,507,194 W778R probably damaging Het
Nbea A G 3: 55,805,266 L2130P possibly damaging Het
Ndst4 A G 3: 125,683,216 N30S probably benign Het
Nphs1 T C 7: 30,462,828 V299A possibly damaging Het
Nup107 T C 10: 117,770,415 D474G probably benign Het
Olfr1118 A C 2: 87,308,995 I89L probably benign Het
Olfr1490 T C 19: 13,654,882 V151A probably benign Het
Olfr225 T A 11: 59,614,073 F370I possibly damaging Het
Olfr8 T C 10: 78,955,697 V164A probably benign Het
Pgap2 T C 7: 102,231,388 V41A probably benign Het
Plekhh1 C T 12: 79,055,047 T297I probably benign Het
Plxna4 A T 6: 32,196,319 Y1226N probably benign Het
Polr3b A G 10: 84,684,179 D653G probably benign Het
Ppp2r2c T C 5: 36,947,142 F289L possibly damaging Het
Prickle2 A G 6: 92,458,543 S82P probably damaging Het
Ptger2 T A 14: 44,989,074 V37D probably damaging Het
Rasa2 G A 9: 96,566,027 P526S probably benign Het
Rbm47 A T 5: 66,026,495 I255N probably damaging Het
Sez6 A T 11: 77,962,891 T296S probably benign Het
Slc2a9 T A 5: 38,391,824 I316F probably damaging Het
Slc41a1 T A 1: 131,839,146 V134D probably damaging Het
Slc5a7 A T 17: 54,297,133 S2T probably benign Het
Slc9a4 C T 1: 40,600,926 R293C probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Suco A G 1: 161,828,214 F1039L possibly damaging Het
Sycp1 A G 3: 102,925,227 Y208H possibly damaging Het
Tpr T C 1: 150,442,127 S2129P probably benign Het
Trim34b T A 7: 104,336,483 S442T probably damaging Het
Ttn A T 2: 76,743,346 Y25734* probably null Het
Uchl5 C T 1: 143,800,014 Q276* probably null Het
Wrn C G 8: 33,248,966 W1278S probably benign Het
Yeats2 T A 16: 20,222,913 D1184E probably damaging Het
Zfat G A 15: 68,184,485 R241W probably damaging Het
Zfp646 T A 7: 127,878,796 Y48* probably null Het
Other mutations in Golga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Golga3 APN 5 110220887 missense probably damaging 1.00
IGL00594:Golga3 APN 5 110204975 missense probably benign 0.37
IGL00672:Golga3 APN 5 110212244 missense probably damaging 1.00
IGL00821:Golga3 APN 5 110204933 missense possibly damaging 0.74
IGL01015:Golga3 APN 5 110187717 missense probably benign 0.04
IGL01408:Golga3 APN 5 110217809 critical splice acceptor site probably null
IGL01651:Golga3 APN 5 110192905 critical splice acceptor site probably null
IGL02617:Golga3 APN 5 110188746 missense probably benign 0.26
tenta UTSW 5 110218130 nonsense probably null
PIT4544001:Golga3 UTSW 5 110188690 missense possibly damaging 0.94
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0591:Golga3 UTSW 5 110188743 missense probably damaging 1.00
R1219:Golga3 UTSW 5 110184349 nonsense probably null
R1297:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1299:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1589:Golga3 UTSW 5 110181783 missense probably damaging 1.00
R1795:Golga3 UTSW 5 110207627 missense possibly damaging 0.47
R1992:Golga3 UTSW 5 110192973 missense probably damaging 0.96
R2116:Golga3 UTSW 5 110187395 missense probably damaging 0.97
R2130:Golga3 UTSW 5 110202939 critical splice donor site probably null
R2153:Golga3 UTSW 5 110187990 splice site probably null
R2158:Golga3 UTSW 5 110187361 missense probably damaging 1.00
R2357:Golga3 UTSW 5 110202648 missense probably damaging 1.00
R2397:Golga3 UTSW 5 110205877 splice site probably benign
R2418:Golga3 UTSW 5 110201868 missense probably damaging 1.00
R2495:Golga3 UTSW 5 110207596 missense probably damaging 0.99
R2763:Golga3 UTSW 5 110204895 missense possibly damaging 0.87
R3276:Golga3 UTSW 5 110201998 splice site probably benign
R3614:Golga3 UTSW 5 110220908 missense probably damaging 1.00
R4520:Golga3 UTSW 5 110203751 nonsense probably null
R5001:Golga3 UTSW 5 110205777 missense probably damaging 1.00
R5046:Golga3 UTSW 5 110192940 missense probably damaging 0.99
R5157:Golga3 UTSW 5 110202671 missense probably benign 0.00
R5191:Golga3 UTSW 5 110184307 intron probably benign
R5376:Golga3 UTSW 5 110220945 critical splice donor site probably null
R5399:Golga3 UTSW 5 110205024 missense probably damaging 0.96
R5407:Golga3 UTSW 5 110201990 nonsense probably null
R5884:Golga3 UTSW 5 110216895 missense probably damaging 1.00
R6087:Golga3 UTSW 5 110204946 missense probably damaging 0.99
R6526:Golga3 UTSW 5 110204895 missense probably damaging 0.98
R6651:Golga3 UTSW 5 110218130 nonsense probably null
R7041:Golga3 UTSW 5 110208584 critical splice donor site probably null
R7057:Golga3 UTSW 5 110188663 missense probably damaging 1.00
R7078:Golga3 UTSW 5 110193087 missense probably damaging 0.99
R7114:Golga3 UTSW 5 110202712 missense probably benign 0.01
R7190:Golga3 UTSW 5 110209855 missense probably damaging 1.00
R7528:Golga3 UTSW 5 110212232 missense probably damaging 1.00
R7638:Golga3 UTSW 5 110205828 missense probably benign
R7760:Golga3 UTSW 5 110205850 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AGCCTTCTGAGTTGGGTTTAGTAA -3'
(R):5'- GGAGCAAAGCACAGCCACT -3'

Sequencing Primer
(F):5'- ACCATGCCTGATGACTTGAG -3'
(R):5'- AGCCACTCTGTTTTTAGCAATGCAG -3'
Posted On2019-09-13