Incidental Mutation 'R7405:Mybpc2'
ID574504
Institutional Source Beutler Lab
Gene Symbol Mybpc2
Ensembl Gene ENSMUSG00000038670
Gene Namemyosin binding protein C, fast-type
SynonymsFast-type C-protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7405 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location44501699-44524656 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44507194 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 778 (W778R)
Ref Sequence ENSEMBL: ENSMUSP00000130127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165208]
PDB Structure
Solution structure of the fibronectin type-III domain of mouse myosin-binding protein C, Fast-type homolog [SOLUTION NMR]
Solution structure of the Ig-like domain(433- 525) of murine myosin-binding protein C, fast-type [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000165208
AA Change: W778R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130127
Gene: ENSMUSG00000038670
AA Change: W778R

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
IG 54 150 6.26e-5 SMART
PDB:2LHU|A 160 236 7e-9 PDB
low complexity region 237 252 N/A INTRINSIC
IG 258 337 5.21e-2 SMART
IG 347 430 1.2e-1 SMART
IG 440 526 2.72e-5 SMART
IG 546 631 1.68e-5 SMART
FN3 634 717 3.29e-11 SMART
FN3 732 815 1.23e-10 SMART
IG 842 925 6.07e-3 SMART
FN3 928 1010 2.08e-8 SMART
IGc2 1055 1122 6.91e-7 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. This family includes the fast-, slow- and cardiac-type isoforms, each of which is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The protein encoded by this locus is referred to as the fast-type isoform. Mutations in the related but distinct genes encoding the slow-type and cardiac-type isoforms have been associated with distal arthrogryposis, type 1 and hypertrophic cardiomyopathy, respectively. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G T 17: 9,001,817 V383L probably damaging Het
1700012P22Rik T C 4: 144,419,753 N110S probably damaging Het
2410141K09Rik T C 13: 66,431,059 Q455R unknown Het
4930507D05Rik C A 10: 62,449,784 H96N unknown Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
5730480H06Rik T C 5: 48,388,116 I235T possibly damaging Het
Abcb11 A G 2: 69,287,619 Y472H probably damaging Het
Adam39 A T 8: 40,824,622 I17L probably benign Het
Aire T C 10: 78,034,613 H458R probably benign Het
Ap3d1 T C 10: 80,741,900 D31G probably benign Het
Atad2b T A 12: 4,943,232 H250Q probably benign Het
Borcs5 C A 6: 134,685,982 T74N probably benign Het
Btbd16 C T 7: 130,805,856 T292I probably benign Het
Catsperd G A 17: 56,632,335 V55M possibly damaging Het
Ctr9 T C 7: 111,043,714 F462S possibly damaging Het
Cyp4f39 A G 17: 32,481,815 S153G probably benign Het
Ddo T C 10: 40,647,997 C328R possibly damaging Het
Ddr1 A G 17: 35,690,100 V251A probably damaging Het
Dis3l A G 9: 64,314,704 F475L probably damaging Het
Dkk4 G A 8: 22,625,843 V99M probably benign Het
Dync1h1 C T 12: 110,634,220 A1938V probably damaging Het
Ecel1 A T 1: 87,153,516 probably null Het
Fbxo7 T A 10: 86,044,581 Y377N probably damaging Het
Fbxw24 T C 9: 109,607,068 I299V possibly damaging Het
Fkbp10 C T 11: 100,415,881 A33V probably damaging Het
Gabra1 T C 11: 42,155,023 T87A probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm884 A T 11: 103,615,161 Y1994N probably benign Het
Golga3 A T 5: 110,208,446 I1000F probably damaging Het
Grid2ip T C 5: 143,380,444 I563T probably benign Het
Gsx1 T C 5: 147,189,133 S82P possibly damaging Het
Heg1 A G 16: 33,763,449 K34E possibly damaging Het
Kank1 T A 19: 25,410,319 L452* probably null Het
Lce1k A T 3: 92,806,874 M1K probably null Het
Lcmt2 A G 2: 121,139,387 I185T probably benign Het
Lrp1 T C 10: 127,581,751 D1046G possibly damaging Het
Mast3 A T 8: 70,786,171 D496E probably damaging Het
Mst1r C T 9: 107,915,122 S925F possibly damaging Het
Mterf2 C T 10: 85,120,496 G88D probably damaging Het
Mthfd1 T C 12: 76,311,874 V783A probably damaging Het
Nbea A G 3: 55,805,266 L2130P possibly damaging Het
Ndst4 A G 3: 125,683,216 N30S probably benign Het
Nphs1 T C 7: 30,462,828 V299A possibly damaging Het
Nup107 T C 10: 117,770,415 D474G probably benign Het
Olfr1118 A C 2: 87,308,995 I89L probably benign Het
Olfr1490 T C 19: 13,654,882 V151A probably benign Het
Olfr225 T A 11: 59,614,073 F370I possibly damaging Het
Olfr8 T C 10: 78,955,697 V164A probably benign Het
Pgap2 T C 7: 102,231,388 V41A probably benign Het
Plekhh1 C T 12: 79,055,047 T297I probably benign Het
Plxna4 A T 6: 32,196,319 Y1226N probably benign Het
Polr3b A G 10: 84,684,179 D653G probably benign Het
Ppp2r2c T C 5: 36,947,142 F289L possibly damaging Het
Prickle2 A G 6: 92,458,543 S82P probably damaging Het
Ptger2 T A 14: 44,989,074 V37D probably damaging Het
Rasa2 G A 9: 96,566,027 P526S probably benign Het
Rbm47 A T 5: 66,026,495 I255N probably damaging Het
Sez6 A T 11: 77,962,891 T296S probably benign Het
Slc2a9 T A 5: 38,391,824 I316F probably damaging Het
Slc41a1 T A 1: 131,839,146 V134D probably damaging Het
Slc5a7 A T 17: 54,297,133 S2T probably benign Het
Slc9a4 C T 1: 40,600,926 R293C probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Suco A G 1: 161,828,214 F1039L possibly damaging Het
Sycp1 A G 3: 102,925,227 Y208H possibly damaging Het
Tpr T C 1: 150,442,127 S2129P probably benign Het
Trim34b T A 7: 104,336,483 S442T probably damaging Het
Ttn A T 2: 76,743,346 Y25734* probably null Het
Uchl5 C T 1: 143,800,014 Q276* probably null Het
Wrn C G 8: 33,248,966 W1278S probably benign Het
Yeats2 T A 16: 20,222,913 D1184E probably damaging Het
Zfat G A 15: 68,184,485 R241W probably damaging Het
Zfp646 T A 7: 127,878,796 Y48* probably null Het
Other mutations in Mybpc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Mybpc2 APN 7 44505405 unclassified probably benign
IGL00586:Mybpc2 APN 7 44505382 missense probably damaging 0.96
IGL00976:Mybpc2 APN 7 44522317 splice site probably null
IGL01099:Mybpc2 APN 7 44516167 missense probably damaging 0.99
IGL01348:Mybpc2 APN 7 44515928 missense probably benign
IGL01625:Mybpc2 APN 7 44516913 missense possibly damaging 0.65
IGL01733:Mybpc2 APN 7 44506198 missense probably benign 0.03
IGL01946:Mybpc2 APN 7 44509898 unclassified probably benign
IGL02078:Mybpc2 APN 7 44503780 missense probably damaging 1.00
IGL02314:Mybpc2 APN 7 44522388 missense possibly damaging 0.82
IGL02341:Mybpc2 APN 7 44514930 missense probably benign 0.00
IGL02904:Mybpc2 APN 7 44522341 missense probably benign 0.05
IGL03034:Mybpc2 APN 7 44511897 missense possibly damaging 0.87
IGL03296:Mybpc2 APN 7 44506884 missense probably damaging 1.00
R0094:Mybpc2 UTSW 7 44516904 missense probably damaging 1.00
R0329:Mybpc2 UTSW 7 44509029 missense possibly damaging 0.94
R0330:Mybpc2 UTSW 7 44509029 missense possibly damaging 0.94
R0336:Mybpc2 UTSW 7 44505616 missense probably damaging 1.00
R0503:Mybpc2 UTSW 7 44512570 unclassified probably benign
R0821:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0822:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0823:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0854:Mybpc2 UTSW 7 44517002 missense probably benign 0.06
R0938:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0939:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0940:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0941:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R1166:Mybpc2 UTSW 7 44505025 missense possibly damaging 0.84
R1219:Mybpc2 UTSW 7 44516034 splice site probably null
R1559:Mybpc2 UTSW 7 44513687 missense probably benign 0.01
R1732:Mybpc2 UTSW 7 44513675 missense probably benign
R1802:Mybpc2 UTSW 7 44512470 missense possibly damaging 0.81
R2157:Mybpc2 UTSW 7 44509845 missense possibly damaging 0.93
R2216:Mybpc2 UTSW 7 44512500 unclassified probably null
R2406:Mybpc2 UTSW 7 44521725 missense possibly damaging 0.62
R2411:Mybpc2 UTSW 7 44506238 missense probably damaging 1.00
R3079:Mybpc2 UTSW 7 44506081 missense probably damaging 1.00
R4663:Mybpc2 UTSW 7 44505642 missense probably damaging 0.99
R4736:Mybpc2 UTSW 7 44512547 missense probably damaging 1.00
R5316:Mybpc2 UTSW 7 44520382 nonsense probably null
R5426:Mybpc2 UTSW 7 44509829 missense probably benign 0.01
R5498:Mybpc2 UTSW 7 44516265 missense probably damaging 1.00
R5539:Mybpc2 UTSW 7 44514893 missense probably benign 0.17
R5644:Mybpc2 UTSW 7 44507053 missense probably benign 0.13
R5909:Mybpc2 UTSW 7 44507091 missense probably damaging 1.00
R6435:Mybpc2 UTSW 7 44506057 missense possibly damaging 0.73
R6662:Mybpc2 UTSW 7 44506166 missense probably benign
R6901:Mybpc2 UTSW 7 44505355 missense probably damaging 0.99
R7188:Mybpc2 UTSW 7 44506193 missense probably benign 0.06
R7389:Mybpc2 UTSW 7 44505604 missense probably benign 0.11
R7553:Mybpc2 UTSW 7 44506147 missense possibly damaging 0.51
R7597:Mybpc2 UTSW 7 44509799 missense probably damaging 1.00
R7772:Mybpc2 UTSW 7 44515924 critical splice donor site probably null
R7824:Mybpc2 UTSW 7 44504860 intron probably null
R8003:Mybpc2 UTSW 7 44509064 missense probably damaging 0.99
R8179:Mybpc2 UTSW 7 44509830 missense probably benign 0.01
R8187:Mybpc2 UTSW 7 44512470 missense possibly damaging 0.81
X0052:Mybpc2 UTSW 7 44507142 missense probably benign 0.23
X0065:Mybpc2 UTSW 7 44505385 missense probably benign 0.01
Z1088:Mybpc2 UTSW 7 44516503 missense possibly damaging 0.47
Z1176:Mybpc2 UTSW 7 44521696 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGAAGAGCTGTGTCAGGG -3'
(R):5'- CATCCTTGAAAATGCGGGTTAC -3'

Sequencing Primer
(F):5'- TAGTGACTGGCTGAAGGA -3'
(R):5'- ACTGATGCTGGTGCTCA -3'
Posted On2019-09-13