Incidental Mutation 'R7405:Pgap2'
ID574505
Institutional Source Beutler Lab
Gene Symbol Pgap2
Ensembl Gene ENSMUSG00000030990
Gene Namepost-GPI attachment to proteins 2
Synonyms1810006G21Rik, Frag1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7405 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location102210208-102238567 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102231388 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 41 (V41A)
Ref Sequence ENSEMBL: ENSMUSP00000113574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033292] [ENSMUST00000119816] [ENSMUST00000120119] [ENSMUST00000120879] [ENSMUST00000126914] [ENSMUST00000129340] [ENSMUST00000138479] [ENSMUST00000138753] [ENSMUST00000140058] [ENSMUST00000142873] [ENSMUST00000143541] [ENSMUST00000145352] [ENSMUST00000146996] [ENSMUST00000153020] [ENSMUST00000156529]
Predicted Effect probably benign
Transcript: ENSMUST00000033292
SMART Domains Protein: ENSMUSP00000033292
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 241 2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119816
SMART Domains Protein: ENSMUSP00000113261
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120119
AA Change: V41A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113574
Gene: ENSMUSG00000030990
AA Change: V41A

DomainStartEndE-ValueType
Pfam:Frag1 16 239 1.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120879
SMART Domains Protein: ENSMUSP00000114016
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 237 7.2e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126914
SMART Domains Protein: ENSMUSP00000114853
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 101 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129340
SMART Domains Protein: ENSMUSP00000119692
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138479
SMART Domains Protein: ENSMUSP00000115590
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 209 5.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138753
SMART Domains Protein: ENSMUSP00000116858
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 123 9.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140058
SMART Domains Protein: ENSMUSP00000122482
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142873
SMART Domains Protein: ENSMUSP00000121988
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 136 3.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143541
SMART Domains Protein: ENSMUSP00000117450
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 79 2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145352
SMART Domains Protein: ENSMUSP00000123523
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146996
SMART Domains Protein: ENSMUSP00000118677
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153020
SMART Domains Protein: ENSMUSP00000123570
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 209 5.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156529
SMART Domains Protein: ENSMUSP00000121521
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 237 7.2e-46 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G T 17: 9,001,817 V383L probably damaging Het
1700012P22Rik T C 4: 144,419,753 N110S probably damaging Het
2410141K09Rik T C 13: 66,431,059 Q455R unknown Het
4930507D05Rik C A 10: 62,449,784 H96N unknown Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
5730480H06Rik T C 5: 48,388,116 I235T possibly damaging Het
Abcb11 A G 2: 69,287,619 Y472H probably damaging Het
Adam39 A T 8: 40,824,622 I17L probably benign Het
Aire T C 10: 78,034,613 H458R probably benign Het
Ap3d1 T C 10: 80,741,900 D31G probably benign Het
Atad2b T A 12: 4,943,232 H250Q probably benign Het
Borcs5 C A 6: 134,685,982 T74N probably benign Het
Btbd16 C T 7: 130,805,856 T292I probably benign Het
Catsperd G A 17: 56,632,335 V55M possibly damaging Het
Ctr9 T C 7: 111,043,714 F462S possibly damaging Het
Cyp4f39 A G 17: 32,481,815 S153G probably benign Het
Ddo T C 10: 40,647,997 C328R possibly damaging Het
Ddr1 A G 17: 35,690,100 V251A probably damaging Het
Dis3l A G 9: 64,314,704 F475L probably damaging Het
Dkk4 G A 8: 22,625,843 V99M probably benign Het
Dync1h1 C T 12: 110,634,220 A1938V probably damaging Het
Ecel1 A T 1: 87,153,516 probably null Het
Fbxo7 T A 10: 86,044,581 Y377N probably damaging Het
Fbxw24 T C 9: 109,607,068 I299V possibly damaging Het
Fkbp10 C T 11: 100,415,881 A33V probably damaging Het
Gabra1 T C 11: 42,155,023 T87A probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm884 A T 11: 103,615,161 Y1994N probably benign Het
Golga3 A T 5: 110,208,446 I1000F probably damaging Het
Grid2ip T C 5: 143,380,444 I563T probably benign Het
Gsx1 T C 5: 147,189,133 S82P possibly damaging Het
Heg1 A G 16: 33,763,449 K34E possibly damaging Het
Kank1 T A 19: 25,410,319 L452* probably null Het
Lce1k A T 3: 92,806,874 M1K probably null Het
Lcmt2 A G 2: 121,139,387 I185T probably benign Het
Lrp1 T C 10: 127,581,751 D1046G possibly damaging Het
Mast3 A T 8: 70,786,171 D496E probably damaging Het
Mst1r C T 9: 107,915,122 S925F possibly damaging Het
Mterf2 C T 10: 85,120,496 G88D probably damaging Het
Mthfd1 T C 12: 76,311,874 V783A probably damaging Het
Mybpc2 A T 7: 44,507,194 W778R probably damaging Het
Nbea A G 3: 55,805,266 L2130P possibly damaging Het
Ndst4 A G 3: 125,683,216 N30S probably benign Het
Nphs1 T C 7: 30,462,828 V299A possibly damaging Het
Nup107 T C 10: 117,770,415 D474G probably benign Het
Olfr1118 A C 2: 87,308,995 I89L probably benign Het
Olfr1490 T C 19: 13,654,882 V151A probably benign Het
Olfr225 T A 11: 59,614,073 F370I possibly damaging Het
Olfr8 T C 10: 78,955,697 V164A probably benign Het
Plekhh1 C T 12: 79,055,047 T297I probably benign Het
Plxna4 A T 6: 32,196,319 Y1226N probably benign Het
Polr3b A G 10: 84,684,179 D653G probably benign Het
Ppp2r2c T C 5: 36,947,142 F289L possibly damaging Het
Prickle2 A G 6: 92,458,543 S82P probably damaging Het
Ptger2 T A 14: 44,989,074 V37D probably damaging Het
Rasa2 G A 9: 96,566,027 P526S probably benign Het
Rbm47 A T 5: 66,026,495 I255N probably damaging Het
Sez6 A T 11: 77,962,891 T296S probably benign Het
Slc2a9 T A 5: 38,391,824 I316F probably damaging Het
Slc41a1 T A 1: 131,839,146 V134D probably damaging Het
Slc5a7 A T 17: 54,297,133 S2T probably benign Het
Slc9a4 C T 1: 40,600,926 R293C probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Suco A G 1: 161,828,214 F1039L possibly damaging Het
Sycp1 A G 3: 102,925,227 Y208H possibly damaging Het
Tpr T C 1: 150,442,127 S2129P probably benign Het
Trim34b T A 7: 104,336,483 S442T probably damaging Het
Ttn A T 2: 76,743,346 Y25734* probably null Het
Uchl5 C T 1: 143,800,014 Q276* probably null Het
Wrn C G 8: 33,248,966 W1278S probably benign Het
Yeats2 T A 16: 20,222,913 D1184E probably damaging Het
Zfat G A 15: 68,184,485 R241W probably damaging Het
Zfp646 T A 7: 127,878,796 Y48* probably null Het
Other mutations in Pgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Pgap2 APN 7 102226454 splice site probably benign
IGL01363:Pgap2 APN 7 102226282 start codon destroyed probably null 1.00
IGL02352:Pgap2 APN 7 102236139 missense probably damaging 1.00
IGL02359:Pgap2 APN 7 102236139 missense probably damaging 1.00
IGL02638:Pgap2 APN 7 102237422 missense probably damaging 1.00
IGL03097:Pgap2 UTSW 7 102236227 missense probably damaging 1.00
PIT4131001:Pgap2 UTSW 7 102237198 missense possibly damaging 0.45
R0452:Pgap2 UTSW 7 102236462 missense probably damaging 1.00
R0747:Pgap2 UTSW 7 102237136 nonsense probably null
R0840:Pgap2 UTSW 7 102237448 missense probably damaging 0.96
R4551:Pgap2 UTSW 7 102226467 intron probably benign
R5122:Pgap2 UTSW 7 102231391 missense probably damaging 1.00
R6440:Pgap2 UTSW 7 102237387 splice site probably null
R7358:Pgap2 UTSW 7 102210567 unclassified probably benign
R7363:Pgap2 UTSW 7 102226260 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCCTCAAGTTGTGCCCTTTG -3'
(R):5'- CTCCTGACCAATCCTACAGGT -3'

Sequencing Primer
(F):5'- TGCCTTGCTTGGACCAC -3'
(R):5'- GACCAATCCTACAGGTCCTCC -3'
Posted On2019-09-13