Incidental Mutation 'R7405:Trim34b'
ID574506
Institutional Source Beutler Lab
Gene Symbol Trim34b
Ensembl Gene ENSMUSG00000090215
Gene Nametripartite motif-containing 34B
SynonymsTrim34-2, Gm15134
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.376) question?
Stock #R7405 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location104329471-104336909 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104336483 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 442 (S442T)
Ref Sequence ENSEMBL: ENSMUSP00000102460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059037] [ENSMUST00000106847] [ENSMUST00000130139] [ENSMUST00000180136]
Predicted Effect probably benign
Transcript: ENSMUST00000059037
SMART Domains Protein: ENSMUSP00000060100
Gene: ENSMUSG00000057143

DomainStartEndE-ValueType
RING 15 58 5.51e-7 SMART
BBOX 91 132 4.83e-12 SMART
low complexity region 196 209 N/A INTRINSIC
Pfam:SPRY 351 493 8.7e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106847
AA Change: S442T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102460
Gene: ENSMUSG00000090215
AA Change: S442T

DomainStartEndE-ValueType
RING 15 58 7.8e-7 SMART
ZnF_RBZ 31 61 5.96e-1 SMART
BBOX 91 132 2.15e-9 SMART
low complexity region 195 209 N/A INTRINSIC
Blast:PRY 299 343 3e-21 BLAST
Pfam:SPRY 347 474 7.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130139
SMART Domains Protein: ENSMUSP00000116775
Gene: ENSMUSG00000057143

DomainStartEndE-ValueType
RING 15 58 5.51e-7 SMART
BBOX 91 132 4.83e-12 SMART
low complexity region 196 209 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000180136
AA Change: S442T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136926
Gene: ENSMUSG00000090215
AA Change: S442T

DomainStartEndE-ValueType
RING 15 58 7.8e-7 SMART
ZnF_RBZ 31 61 5.96e-1 SMART
BBOX 91 132 2.15e-9 SMART
low complexity region 195 209 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 3e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G T 17: 9,001,817 V383L probably damaging Het
1700012P22Rik T C 4: 144,419,753 N110S probably damaging Het
2410141K09Rik T C 13: 66,431,059 Q455R unknown Het
4930507D05Rik C A 10: 62,449,784 H96N unknown Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
5730480H06Rik T C 5: 48,388,116 I235T possibly damaging Het
Abcb11 A G 2: 69,287,619 Y472H probably damaging Het
Adam39 A T 8: 40,824,622 I17L probably benign Het
Aire T C 10: 78,034,613 H458R probably benign Het
Ap3d1 T C 10: 80,741,900 D31G probably benign Het
Atad2b T A 12: 4,943,232 H250Q probably benign Het
Borcs5 C A 6: 134,685,982 T74N probably benign Het
Btbd16 C T 7: 130,805,856 T292I probably benign Het
Catsperd G A 17: 56,632,335 V55M possibly damaging Het
Ctr9 T C 7: 111,043,714 F462S possibly damaging Het
Cyp4f39 A G 17: 32,481,815 S153G probably benign Het
Ddo T C 10: 40,647,997 C328R possibly damaging Het
Ddr1 A G 17: 35,690,100 V251A probably damaging Het
Dis3l A G 9: 64,314,704 F475L probably damaging Het
Dkk4 G A 8: 22,625,843 V99M probably benign Het
Dync1h1 C T 12: 110,634,220 A1938V probably damaging Het
Ecel1 A T 1: 87,153,516 probably null Het
Fbxo7 T A 10: 86,044,581 Y377N probably damaging Het
Fbxw24 T C 9: 109,607,068 I299V possibly damaging Het
Fkbp10 C T 11: 100,415,881 A33V probably damaging Het
Gabra1 T C 11: 42,155,023 T87A probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm884 A T 11: 103,615,161 Y1994N probably benign Het
Golga3 A T 5: 110,208,446 I1000F probably damaging Het
Grid2ip T C 5: 143,380,444 I563T probably benign Het
Gsx1 T C 5: 147,189,133 S82P possibly damaging Het
Heg1 A G 16: 33,763,449 K34E possibly damaging Het
Kank1 T A 19: 25,410,319 L452* probably null Het
Lce1k A T 3: 92,806,874 M1K probably null Het
Lcmt2 A G 2: 121,139,387 I185T probably benign Het
Lrp1 T C 10: 127,581,751 D1046G possibly damaging Het
Mast3 A T 8: 70,786,171 D496E probably damaging Het
Mst1r C T 9: 107,915,122 S925F possibly damaging Het
Mterf2 C T 10: 85,120,496 G88D probably damaging Het
Mthfd1 T C 12: 76,311,874 V783A probably damaging Het
Mybpc2 A T 7: 44,507,194 W778R probably damaging Het
Nbea A G 3: 55,805,266 L2130P possibly damaging Het
Ndst4 A G 3: 125,683,216 N30S probably benign Het
Nphs1 T C 7: 30,462,828 V299A possibly damaging Het
Nup107 T C 10: 117,770,415 D474G probably benign Het
Olfr1118 A C 2: 87,308,995 I89L probably benign Het
Olfr1490 T C 19: 13,654,882 V151A probably benign Het
Olfr225 T A 11: 59,614,073 F370I possibly damaging Het
Olfr8 T C 10: 78,955,697 V164A probably benign Het
Pgap2 T C 7: 102,231,388 V41A probably benign Het
Plekhh1 C T 12: 79,055,047 T297I probably benign Het
Plxna4 A T 6: 32,196,319 Y1226N probably benign Het
Polr3b A G 10: 84,684,179 D653G probably benign Het
Ppp2r2c T C 5: 36,947,142 F289L possibly damaging Het
Prickle2 A G 6: 92,458,543 S82P probably damaging Het
Ptger2 T A 14: 44,989,074 V37D probably damaging Het
Rasa2 G A 9: 96,566,027 P526S probably benign Het
Rbm47 A T 5: 66,026,495 I255N probably damaging Het
Sez6 A T 11: 77,962,891 T296S probably benign Het
Slc2a9 T A 5: 38,391,824 I316F probably damaging Het
Slc41a1 T A 1: 131,839,146 V134D probably damaging Het
Slc5a7 A T 17: 54,297,133 S2T probably benign Het
Slc9a4 C T 1: 40,600,926 R293C probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Suco A G 1: 161,828,214 F1039L possibly damaging Het
Sycp1 A G 3: 102,925,227 Y208H possibly damaging Het
Tpr T C 1: 150,442,127 S2129P probably benign Het
Ttn A T 2: 76,743,346 Y25734* probably null Het
Uchl5 C T 1: 143,800,014 Q276* probably null Het
Wrn C G 8: 33,248,966 W1278S probably benign Het
Yeats2 T A 16: 20,222,913 D1184E probably damaging Het
Zfat G A 15: 68,184,485 R241W probably damaging Het
Zfp646 T A 7: 127,878,796 Y48* probably null Het
Other mutations in Trim34b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Trim34b APN 7 104329652 nonsense probably null
IGL01103:Trim34b APN 7 104329899 missense probably damaging 1.00
IGL02252:Trim34b APN 7 104329932 missense probably damaging 0.98
IGL03241:Trim34b APN 7 104334613 intron probably benign
R0032:Trim34b UTSW 7 104336577 missense possibly damaging 0.61
R0381:Trim34b UTSW 7 104329855 missense probably damaging 1.00
R2403:Trim34b UTSW 7 104329669 missense probably benign
R2520:Trim34b UTSW 7 104331239 missense probably damaging 1.00
R2857:Trim34b UTSW 7 104336232 missense probably benign 0.00
R2859:Trim34b UTSW 7 104336232 missense probably benign 0.00
R3077:Trim34b UTSW 7 104331301 missense possibly damaging 0.89
R4094:Trim34b UTSW 7 104334588 missense probably benign
R4449:Trim34b UTSW 7 104335728 missense probably benign 0.00
R5183:Trim34b UTSW 7 104329911 missense possibly damaging 0.92
R5700:Trim34b UTSW 7 104336411 missense probably damaging 1.00
R5759:Trim34b UTSW 7 104331433 missense possibly damaging 0.46
R6236:Trim34b UTSW 7 104336318 missense probably damaging 0.99
R6364:Trim34b UTSW 7 104336526 missense probably damaging 0.99
R7034:Trim34b UTSW 7 104329536 start gained probably benign
R7036:Trim34b UTSW 7 104329536 start gained probably benign
R7237:Trim34b UTSW 7 104329587 missense possibly damaging 0.80
R7392:Trim34b UTSW 7 104336397 missense probably benign 0.00
R7516:Trim34b UTSW 7 104329711 missense probably damaging 1.00
R7646:Trim34b UTSW 7 104335352 missense probably damaging 0.97
R7909:Trim34b UTSW 7 104330524 missense probably benign 0.01
Z1176:Trim34b UTSW 7 104335314 missense probably damaging 1.00
Z1177:Trim34b UTSW 7 104331353 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CAAAGGTCAGCCAAATGGTTAC -3'
(R):5'- TGAACAGCACAGGTCCATCC -3'

Sequencing Primer
(F):5'- GGTCAGCCAAATGGTTACCACAG -3'
(R):5'- GGTCCATCCACACGGTAAG -3'
Posted On2019-09-13