Mutagenetix > Incidental Mutation

Incidental Mutation 'R7405:Mast3'

574513

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7405 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70786171 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 496 (D496E)

Ref Sequence

ENSEMBL: ENSMUSP00000148686 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]

AlphaFold

Q3U214

Predicted Effect

probably damaging
Transcript: ENSMUST00000166004
AA Change: D512E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: D512E

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000211948
AA Change: D496E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000212001

Predicted Effect

probably benign
Transcript: ENSMUST00000212038

Predicted Effect

probably benign
Transcript: ENSMUST00000212140

Predicted Effect

probably benign
Transcript: ENSMUST00000212551

Predicted Effect

probably benign
Transcript: ENSMUST00000212673

Predicted Effect

probably benign
Transcript: ENSMUST00000212757

Predicted Effect

probably benign
Transcript: ENSMUST00000212875

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	G	T	17: 9,001,817	V383L	probably damaging	Het
1700012P22Rik	T	C	4: 144,419,753	N110S	probably damaging	Het
2410141K09Rik	T	C	13: 66,431,059	Q455R	unknown	Het
4930507D05Rik	C	A	10: 62,449,784	H96N	unknown	Het
4930539E08Rik	G	A	17: 28,905,324	R335W	probably damaging	Het
5730480H06Rik	T	C	5: 48,388,116	I235T	possibly damaging	Het
Abcb11	A	G	2: 69,287,619	Y472H	probably damaging	Het
Adam39	A	T	8: 40,824,622	I17L	probably benign	Het
Aire	T	C	10: 78,034,613	H458R	probably benign	Het
Ap3d1	T	C	10: 80,741,900	D31G	probably benign	Het
Atad2b	T	A	12: 4,943,232	H250Q	probably benign	Het
Borcs5	C	A	6: 134,685,982	T74N	probably benign	Het
Btbd16	C	T	7: 130,805,856	T292I	probably benign	Het
Catsperd	G	A	17: 56,632,335	V55M	possibly damaging	Het
Ctr9	T	C	7: 111,043,714	F462S	possibly damaging	Het
Cyp4f39	A	G	17: 32,481,815	S153G	probably benign	Het
Ddo	T	C	10: 40,647,997	C328R	possibly damaging	Het
Ddr1	A	G	17: 35,690,100	V251A	probably damaging	Het
Dis3l	A	G	9: 64,314,704	F475L	probably damaging	Het
Dkk4	G	A	8: 22,625,843	V99M	probably benign	Het
Dync1h1	C	T	12: 110,634,220	A1938V	probably damaging	Het
Ecel1	A	T	1: 87,153,516		probably null	Het
Fbxo7	T	A	10: 86,044,581	Y377N	probably damaging	Het
Fbxw24	T	C	9: 109,607,068	I299V	possibly damaging	Het
Fkbp10	C	T	11: 100,415,881	A33V	probably damaging	Het
Gabra1	T	C	11: 42,155,023	T87A	probably damaging	Het
Gm21886	ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG	ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG	18: 80,089,825		probably benign	Het
Gm884	A	T	11: 103,615,161	Y1994N	probably benign	Het
Golga3	A	T	5: 110,208,446	I1000F	probably damaging	Het
Grid2ip	T	C	5: 143,380,444	I563T	probably benign	Het
Gsx1	T	C	5: 147,189,133	S82P	possibly damaging	Het
Heg1	A	G	16: 33,763,449	K34E	possibly damaging	Het
Kank1	T	A	19: 25,410,319	L452*	probably null	Het
Lce1k	A	T	3: 92,806,874	M1K	probably null	Het
Lcmt2	A	G	2: 121,139,387	I185T	probably benign	Het
Lrp1	T	C	10: 127,581,751	D1046G	possibly damaging	Het
Mst1r	C	T	9: 107,915,122	S925F	possibly damaging	Het
Mterf2	C	T	10: 85,120,496	G88D	probably damaging	Het
Mthfd1	T	C	12: 76,311,874	V783A	probably damaging	Het
Mybpc2	A	T	7: 44,507,194	W778R	probably damaging	Het
Nbea	A	G	3: 55,805,266	L2130P	possibly damaging	Het
Ndst4	A	G	3: 125,683,216	N30S	probably benign	Het
Nphs1	T	C	7: 30,462,828	V299A	possibly damaging	Het
Nup107	T	C	10: 117,770,415	D474G	probably benign	Het
Olfr1118	A	C	2: 87,308,995	I89L	probably benign	Het
Olfr1490	T	C	19: 13,654,882	V151A	probably benign	Het
Olfr225	T	A	11: 59,614,073	F370I	possibly damaging	Het
Olfr8	T	C	10: 78,955,697	V164A	probably benign	Het
Pgap2	T	C	7: 102,231,388	V41A	probably benign	Het
Plekhh1	C	T	12: 79,055,047	T297I	probably benign	Het
Plxna4	A	T	6: 32,196,319	Y1226N	probably benign	Het
Polr3b	A	G	10: 84,684,179	D653G	probably benign	Het
Ppp2r2c	T	C	5: 36,947,142	F289L	possibly damaging	Het
Prickle2	A	G	6: 92,458,543	S82P	probably damaging	Het
Ptger2	T	A	14: 44,989,074	V37D	probably damaging	Het
Rasa2	G	A	9: 96,566,027	P526S	probably benign	Het
Rbm47	A	T	5: 66,026,495	I255N	probably damaging	Het
Sez6	A	T	11: 77,962,891	T296S	probably benign	Het
Slc2a9	T	A	5: 38,391,824	I316F	probably damaging	Het
Slc41a1	T	A	1: 131,839,146	V134D	probably damaging	Het
Slc5a7	A	T	17: 54,297,133	S2T	probably benign	Het
Slc9a4	C	T	1: 40,600,926	R293C	probably damaging	Het
Son	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	16: 91,656,691		probably benign	Het
Suco	A	G	1: 161,828,214	F1039L	possibly damaging	Het
Sycp1	A	G	3: 102,925,227	Y208H	possibly damaging	Het
Tpr	T	C	1: 150,442,127	S2129P	probably benign	Het
Trim34b	T	A	7: 104,336,483	S442T	probably damaging	Het
Ttn	A	T	2: 76,743,346	Y25734*	probably null	Het
Uchl5	C	T	1: 143,800,014	Q276*	probably null	Het
Wrn	C	G	8: 33,248,966	W1278S	probably benign	Het
Yeats2	T	A	16: 20,222,913	D1184E	probably damaging	Het
Zfat	G	A	15: 68,184,485	R241W	probably damaging	Het
Zfp646	T	A	7: 127,878,796	Y48*	probably null	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTTCCACCCTAAAGGCAGAG -3'
(R):5'- ATCTTAGAATGCTACCCTGCTG -3'

Sequencing Primer
(F):5'- CAGAGCAGGTGCATGTGTG -3'
(R):5'- TGCTGGGCAGAACCTATAGACC -3'

Posted On

2019-09-13