Incidental Mutation 'R0626:Unc80'
ID 57452
Institutional Source Beutler Lab
Gene Symbol Unc80
Ensembl Gene ENSMUSG00000055567
Gene Name unc-80, NALCN activator
Synonyms C030018G13Rik, C230061B10Rik
MMRRC Submission 038815-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock # R0626 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 66468367-66699148 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 66608442 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 1514 (S1514G)
Ref Sequence ENSEMBL: ENSMUSP00000053692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061620] [ENSMUST00000212557]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000061620
AA Change: S1514G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000053692
Gene: ENSMUSG00000055567
AA Change: S1514G

Pfam:UNC80 16 236 2.2e-94 PFAM
low complexity region 372 385 N/A INTRINSIC
low complexity region 493 502 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 739 769 N/A INTRINSIC
low complexity region 1038 1055 N/A INTRINSIC
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1309 1328 N/A INTRINSIC
low complexity region 1477 1489 N/A INTRINSIC
low complexity region 1676 1681 N/A INTRINSIC
low complexity region 1842 1848 N/A INTRINSIC
low complexity region 1854 1868 N/A INTRINSIC
low complexity region 2461 2480 N/A INTRINSIC
low complexity region 2726 2740 N/A INTRINSIC
low complexity region 3121 3144 N/A INTRINSIC
low complexity region 3245 3254 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000212557
AA Change: S1446G
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a voltage-independent 'leak' ion-channel complex, in which it performs essential functions, such as serving as a bridge between two other components (sodium leak channel non-selective and UNC79) and as a scaffold for Src kinases. Leak channels play an importnat role in establishment and maintenance of resting membrane potentials in neurons. Mutations in this gene are associated with congenital infantile encephalopathy, intellectual disability and growth issues. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,788,721 probably benign Het
6430571L13Rik T A 9: 107,342,508 D53E possibly damaging Het
A2ml1 T A 6: 128,550,773 N1018I probably damaging Het
Abi3 C A 11: 95,837,111 A85S probably benign Het
Acsl5 A T 19: 55,284,472 M340L probably benign Het
Adam29 T A 8: 55,871,577 H614L probably benign Het
Adgrg6 A T 10: 14,436,884 S720T probably damaging Het
Adrb2 G T 18: 62,179,370 A128E probably damaging Het
Afap1l1 T C 18: 61,739,220 E510G probably benign Het
Angel1 A G 12: 86,717,713 probably null Het
Aox3 T G 1: 58,172,299 I1005S possibly damaging Het
Apc C A 18: 34,318,454 P2767Q probably damaging Het
Apob T G 12: 8,016,193 D4387E probably benign Het
Apobr T C 7: 126,586,655 V446A possibly damaging Het
Arhgap28 A T 17: 67,896,113 probably null Het
Aspm G T 1: 139,491,601 K3001N probably damaging Het
Asxl3 G T 18: 22,522,880 V1316F probably benign Het
Atp2a1 T A 7: 126,446,990 probably null Het
Bach1 A G 16: 87,729,471 D607G possibly damaging Het
Batf3 A G 1: 191,100,738 D27G probably damaging Het
Baz1a G T 12: 54,975,270 Q76K probably damaging Het
Bdnf G A 2: 109,723,538 V86M probably benign Het
Birc7 A G 2: 180,931,305 I172V probably benign Het
Bod1l A C 5: 41,831,537 V409G probably damaging Het
Cacna1e T A 1: 154,488,817 E337V probably damaging Het
Cacna1h A G 17: 25,393,546 F287L possibly damaging Het
Ces1e A G 8: 93,224,043 Y37H probably benign Het
Clasrp A T 7: 19,584,493 probably benign Het
Clec2d T A 6: 129,183,127 S35T probably damaging Het
Cntn4 T A 6: 106,662,578 D556E probably benign Het
Cntnap5c A T 17: 58,042,427 D245V probably benign Het
Col5a1 T A 2: 27,928,243 L160* probably null Het
Col6a6 T C 9: 105,777,744 E926G probably benign Het
Cpsf2 T A 12: 101,985,231 H142Q probably benign Het
Cr2 A C 1: 195,171,111 S20A possibly damaging Het
Cyp2j5 A T 4: 96,659,512 H164Q probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dmbt1 G A 7: 131,102,081 V1124M probably damaging Het
Dmxl2 T C 9: 54,416,554 H1182R probably damaging Het
Dnah2 A T 11: 69,477,683 S1709T probably benign Het
Dopey2 T C 16: 93,763,956 V776A probably damaging Het
Emc3 T C 6: 113,516,031 T220A probably benign Het
Entpd1 A C 19: 40,727,325 N312T probably benign Het
Fam8a1 A T 13: 46,671,223 I229F probably damaging Het
Fancc G A 13: 63,317,391 P501S probably damaging Het
Fasn T C 11: 120,811,925 R1704G probably damaging Het
Fsip2 A G 2: 82,988,958 I5012V probably benign Het
Glce T C 9: 62,061,000 T290A probably benign Het
Gm648 G A X: 56,545,039 P134L probably benign Het
Gns G A 10: 121,383,444 probably null Het
Gsdma2 A G 11: 98,651,984 N190S probably damaging Het
Hectd4 T A 5: 121,277,824 S563T probably benign Het
Hmcn1 T C 1: 150,798,719 probably null Het
Jup A T 11: 100,376,763 M578K probably benign Het
Kir3dl1 G A X: 136,533,845 probably null Het
Krt75 A G 15: 101,573,590 F81S probably benign Het
Lrp1 G T 10: 127,567,364 D2113E probably damaging Het
Maged2 T A X: 150,811,834 N176Y probably damaging Het
Mrc1 T A 2: 14,328,571 C1354* probably null Het
Mup7 A C 4: 60,069,742 V74G possibly damaging Het
Naca A G 10: 128,041,162 probably benign Het
Nav3 T G 10: 109,823,464 Y764S probably damaging Het
Nkpd1 A T 7: 19,523,174 T293S probably benign Het
Numb A G 12: 83,795,840 Y510H probably damaging Het
Nynrin T G 14: 55,868,035 L834R probably damaging Het
Olfr1537 T A 9: 39,237,866 N186I possibly damaging Het
Olfr318 G T 11: 58,720,521 H176N probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Otog T C 7: 46,271,373 V1000A possibly damaging Het
Pafah1b3 A G 7: 25,297,129 V43A possibly damaging Het
Pcnx A G 12: 81,983,676 Y1775C possibly damaging Het
Phka1 G A X: 102,520,831 R1074C probably damaging Het
Pi4ka T A 16: 17,293,901 Y1570F probably benign Het
Piezo2 T C 18: 63,019,258 K2588E probably damaging Het
Pkd1 A G 17: 24,575,575 T2079A probably damaging Het
Plekhd1 G T 12: 80,717,301 Q212H probably damaging Het
Plekhh1 C T 12: 79,040,585 R16* probably null Het
Polm C A 11: 5,836,207 R120L probably damaging Het
Ptpn22 T C 3: 103,860,405 M1T probably null Het
Ptprh G A 7: 4,564,272 L534F probably benign Het
Rabl6 C T 2: 25,592,766 probably null Het
Rap2a A G 14: 120,478,991 S89G probably damaging Het
Rara A T 11: 98,971,580 probably null Het
Reck A G 4: 43,930,295 D623G probably benign Het
Relt A T 7: 100,848,816 L237Q probably damaging Het
Rngtt A G 4: 33,329,598 probably null Het
Rtn4rl2 T G 2: 84,880,419 Y167S probably damaging Het
Sec24c C T 14: 20,688,437 R353C probably damaging Het
Slc35g2 T C 9: 100,553,442 S59G probably benign Het
Smarcd2 A T 11: 106,267,415 M107K probably benign Het
Smg1 T C 7: 118,182,383 N1227S possibly damaging Het
Snrnp200 A G 2: 127,221,814 N638D possibly damaging Het
Sntb1 A G 15: 55,642,783 S465P probably benign Het
Sp4 A G 12: 118,299,579 L244P probably damaging Het
Sulf1 A G 1: 12,817,492 probably null Het
Tbc1d17 T C 7: 44,843,085 T385A probably benign Het
Tbx10 C A 19: 3,997,873 D206E probably benign Het
Tcea2 C T 2: 181,687,638 P275S probably damaging Het
Tns3 C A 11: 8,493,121 R414L probably benign Het
Trip11 T C 12: 101,885,976 R610G possibly damaging Het
Ugt2b1 T C 5: 86,925,861 K213R probably null Het
Usp7 G T 16: 8,693,914 Q867K possibly damaging Het
Vim T C 2: 13,574,652 V74A probably benign Het
Vmn1r234 A G 17: 21,229,745 Y307C probably benign Het
Vmn2r74 A T 7: 85,961,309 Y58* probably null Het
Wdr36 C A 18: 32,850,531 A445E probably damaging Het
Xpo5 T A 17: 46,221,433 W465R probably damaging Het
Zscan4d T A 7: 11,165,019 R110S probably damaging Het
Other mutations in Unc80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Unc80 APN 1 66654395 missense possibly damaging 0.53
IGL00340:Unc80 APN 1 66606459 missense possibly damaging 0.73
IGL00783:Unc80 APN 1 66608437 missense probably benign 0.37
IGL00784:Unc80 APN 1 66608437 missense probably benign 0.37
IGL00935:Unc80 APN 1 66627266 missense possibly damaging 0.53
IGL01094:Unc80 APN 1 66695433 missense possibly damaging 0.90
IGL01466:Unc80 APN 1 66622486 missense probably benign 0.33
IGL01577:Unc80 APN 1 66529968 splice site probably null
IGL01626:Unc80 APN 1 66551054 critical splice donor site probably null
IGL01640:Unc80 APN 1 66679585 missense probably benign 0.33
IGL01775:Unc80 APN 1 66601056 missense possibly damaging 0.94
IGL01960:Unc80 APN 1 66608500 splice site probably benign
IGL01991:Unc80 APN 1 66469509 nonsense probably null
IGL02022:Unc80 APN 1 66626516 missense possibly damaging 0.53
IGL02073:Unc80 APN 1 66612227 missense possibly damaging 0.85
IGL02077:Unc80 APN 1 66525716 missense possibly damaging 0.77
IGL02197:Unc80 APN 1 66530065 missense probably benign 0.39
IGL02198:Unc80 APN 1 66529986 missense possibly damaging 0.88
IGL02228:Unc80 APN 1 66608428 missense possibly damaging 0.72
IGL02327:Unc80 APN 1 66641673 missense probably benign 0.33
IGL02447:Unc80 APN 1 66503544 missense possibly damaging 0.86
IGL02489:Unc80 APN 1 66525701 missense probably benign 0.07
IGL02546:Unc80 APN 1 66554953 missense possibly damaging 0.83
IGL02629:Unc80 APN 1 66483317 missense possibly damaging 0.46
IGL02631:Unc80 APN 1 66530063 missense probably damaging 0.98
IGL02839:Unc80 APN 1 66671675 missense possibly damaging 0.53
IGL02960:Unc80 APN 1 66678058 splice site probably benign
IGL02974:Unc80 APN 1 66525658 missense possibly damaging 0.95
IGL03060:Unc80 APN 1 66637010 missense possibly damaging 0.96
IGL03062:Unc80 APN 1 66509489 missense probably damaging 0.96
IGL03074:Unc80 APN 1 66671718 splice site probably benign
IGL03086:Unc80 APN 1 66509474 missense probably damaging 0.99
IGL03105:Unc80 APN 1 66472099 missense probably damaging 0.96
IGL03107:Unc80 APN 1 66631454 missense probably damaging 0.98
IGL03158:Unc80 APN 1 66641674 missense probably benign 0.33
IGL03220:Unc80 APN 1 66504938 missense probably damaging 0.99
IGL03271:Unc80 APN 1 66695603 unclassified probably benign
IGL03332:Unc80 APN 1 66503631 missense probably damaging 1.00
IGL03347:Unc80 APN 1 66695466 missense probably damaging 1.00
R0012:Unc80 UTSW 1 66507391 missense probably damaging 1.00
R0012:Unc80 UTSW 1 66507391 missense probably damaging 1.00
R0026:Unc80 UTSW 1 66521584 missense probably benign 0.27
R0055:Unc80 UTSW 1 66506623 splice site probably benign
R0149:Unc80 UTSW 1 66521601 missense possibly damaging 0.82
R0325:Unc80 UTSW 1 66510881 missense probably damaging 1.00
R0329:Unc80 UTSW 1 66674087 missense possibly damaging 0.96
R0330:Unc80 UTSW 1 66674087 missense possibly damaging 0.96
R0355:Unc80 UTSW 1 66549856 missense possibly damaging 0.77
R0412:Unc80 UTSW 1 66550937 splice site probably benign
R0422:Unc80 UTSW 1 66483338 missense probably damaging 1.00
R0477:Unc80 UTSW 1 66570001 missense probably damaging 0.99
R0507:Unc80 UTSW 1 66527893 missense possibly damaging 0.66
R0513:Unc80 UTSW 1 66622474 missense possibly damaging 0.73
R0553:Unc80 UTSW 1 66506669 missense probably damaging 0.97
R0655:Unc80 UTSW 1 66503781 missense probably damaging 0.98
R0742:Unc80 UTSW 1 66527893 missense possibly damaging 0.66
R0755:Unc80 UTSW 1 66504923 missense probably damaging 1.00
R0782:Unc80 UTSW 1 66622581 missense possibly damaging 0.53
R0837:Unc80 UTSW 1 66648944 missense possibly damaging 0.73
R0841:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R0893:Unc80 UTSW 1 66521486 missense probably damaging 0.97
R0900:Unc80 UTSW 1 66671598 missense probably benign 0.33
R0924:Unc80 UTSW 1 66510641 missense possibly damaging 0.95
R0930:Unc80 UTSW 1 66510641 missense possibly damaging 0.95
R0989:Unc80 UTSW 1 66646440 missense possibly damaging 0.53
R1145:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R1145:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R1224:Unc80 UTSW 1 66471980 missense probably damaging 1.00
R1240:Unc80 UTSW 1 66635902 missense possibly damaging 0.85
R1245:Unc80 UTSW 1 66555095 missense possibly damaging 0.94
R1467:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1473:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1500:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1556:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1562:Unc80 UTSW 1 66637957 missense probably damaging 1.00
R1655:Unc80 UTSW 1 66672756 missense possibly damaging 0.86
R1674:Unc80 UTSW 1 66509308 missense probably damaging 1.00
R1680:Unc80 UTSW 1 66503669 nonsense probably null
R1739:Unc80 UTSW 1 66527892 missense probably damaging 0.97
R1756:Unc80 UTSW 1 66639248 missense possibly damaging 0.53
R1783:Unc80 UTSW 1 66683273 missense probably benign 0.01
R1834:Unc80 UTSW 1 66639248 missense possibly damaging 0.53
R1854:Unc80 UTSW 1 66631414 missense possibly damaging 0.93
R1871:Unc80 UTSW 1 66510717 missense possibly damaging 0.77
R1878:Unc80 UTSW 1 66509402 missense probably damaging 0.96
R1883:Unc80 UTSW 1 66525770 missense possibly damaging 0.89
R1912:Unc80 UTSW 1 66510625 missense probably damaging 1.00
R1990:Unc80 UTSW 1 66692549 missense probably damaging 0.97
R2007:Unc80 UTSW 1 66503776 missense probably damaging 1.00
R2035:Unc80 UTSW 1 66606593 missense probably damaging 0.98
R2056:Unc80 UTSW 1 66640552 missense possibly damaging 0.72
R2060:Unc80 UTSW 1 66640595 missense possibly damaging 0.53
R2074:Unc80 UTSW 1 66679744 critical splice donor site probably null
R2088:Unc80 UTSW 1 66590227 missense possibly damaging 0.77
R2089:Unc80 UTSW 1 66671715 splice site probably benign
R2091:Unc80 UTSW 1 66671715 splice site probably benign
R2139:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2169:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2175:Unc80 UTSW 1 66677355 missense probably damaging 1.00
R2248:Unc80 UTSW 1 66623206 splice site probably benign
R2255:Unc80 UTSW 1 66618258 missense possibly damaging 0.53
R2308:Unc80 UTSW 1 66648997 missense possibly damaging 0.53
R2484:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2507:Unc80 UTSW 1 66612107 missense possibly damaging 0.53
R2512:Unc80 UTSW 1 66671608 missense possibly damaging 0.70
R2878:Unc80 UTSW 1 66671576 critical splice acceptor site probably benign
R3040:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3104:Unc80 UTSW 1 66623291 missense probably benign 0.33
R3402:Unc80 UTSW 1 66510686 missense probably damaging 0.97
R3403:Unc80 UTSW 1 66510686 missense probably damaging 0.97
R3413:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3426:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3427:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3428:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3904:Unc80 UTSW 1 66639296 nonsense probably null
R3916:Unc80 UTSW 1 66677495 missense probably benign 0.11
R3950:Unc80 UTSW 1 66622570 missense possibly damaging 0.53
R4642:Unc80 UTSW 1 66671714 splice site probably null
R4646:Unc80 UTSW 1 66669235 missense probably benign 0.03
R4655:Unc80 UTSW 1 66671662 missense probably benign 0.18
R4662:Unc80 UTSW 1 66646436 missense probably benign 0.01
R4720:Unc80 UTSW 1 66510792 missense possibly damaging 0.92
R4736:Unc80 UTSW 1 66649672 critical splice acceptor site probably null
R4795:Unc80 UTSW 1 66527941 missense probably damaging 0.97
R4888:Unc80 UTSW 1 66644447 missense probably damaging 0.98
R4917:Unc80 UTSW 1 66646550 missense possibly damaging 0.86
R4918:Unc80 UTSW 1 66646550 missense possibly damaging 0.86
R4983:Unc80 UTSW 1 66674732 splice site probably null
R5051:Unc80 UTSW 1 66509477 missense probably damaging 0.96
R5111:Unc80 UTSW 1 66527995 missense possibly damaging 0.66
R5122:Unc80 UTSW 1 66679590 missense possibly damaging 0.53
R5260:Unc80 UTSW 1 66646587 missense possibly damaging 0.53
R5351:Unc80 UTSW 1 66606513 missense possibly damaging 0.73
R5387:Unc80 UTSW 1 66530021 missense possibly damaging 0.77
R5437:Unc80 UTSW 1 66654578 missense possibly damaging 0.96
R5525:Unc80 UTSW 1 66606614 missense possibly damaging 0.72
R5621:Unc80 UTSW 1 66638043 missense possibly damaging 0.53
R5690:Unc80 UTSW 1 66640572 missense probably benign 0.08
R5762:Unc80 UTSW 1 66693796 missense possibly damaging 0.82
R5956:Unc80 UTSW 1 66527964 missense probably damaging 0.97
R6005:Unc80 UTSW 1 66627257 missense possibly damaging 0.53
R6025:Unc80 UTSW 1 66695568 missense possibly damaging 0.90
R6033:Unc80 UTSW 1 66473260 missense possibly damaging 0.92
R6033:Unc80 UTSW 1 66473260 missense possibly damaging 0.92
R6117:Unc80 UTSW 1 66675067 missense possibly damaging 0.72
R6156:Unc80 UTSW 1 66612250 missense probably benign 0.01
R6157:Unc80 UTSW 1 66654029 nonsense probably null
R6189:Unc80 UTSW 1 66677471 missense probably benign 0.33
R6291:Unc80 UTSW 1 66521597 missense possibly damaging 0.82
R6367:Unc80 UTSW 1 66672766 missense probably benign 0.33
R6598:Unc80 UTSW 1 66468540 critical splice donor site probably null
R6724:Unc80 UTSW 1 66683191 missense possibly damaging 0.90
R6763:Unc80 UTSW 1 66521477 missense probably benign 0.00
R6773:Unc80 UTSW 1 66651543 missense probably benign 0.33
R6883:Unc80 UTSW 1 66646404 missense probably benign 0.33
R6951:Unc80 UTSW 1 66648511 missense possibly damaging 0.53
R6965:Unc80 UTSW 1 66646566 missense probably benign 0.33
R6993:Unc80 UTSW 1 66549793 missense possibly damaging 0.60
R7041:Unc80 UTSW 1 66503593 missense probably benign 0.00
R7050:Unc80 UTSW 1 66550908 splice site probably null
R7067:Unc80 UTSW 1 66646572 missense possibly damaging 0.86
R7080:Unc80 UTSW 1 66646521 missense possibly damaging 0.53
R7193:Unc80 UTSW 1 66549784 missense possibly damaging 0.60
R7197:Unc80 UTSW 1 66521566 nonsense probably null
R7278:Unc80 UTSW 1 66552209 missense possibly damaging 0.82
R7290:Unc80 UTSW 1 66601197 missense probably damaging 0.97
R7391:Unc80 UTSW 1 66695528 missense probably benign 0.18
R7401:Unc80 UTSW 1 66646415 missense possibly damaging 0.96
R7470:Unc80 UTSW 1 66622462 missense probably benign 0.02
R7573:Unc80 UTSW 1 66521537 missense probably damaging 1.00
R7637:Unc80 UTSW 1 66672684 missense possibly damaging 0.86
R7678:Unc80 UTSW 1 66649722 missense probably benign 0.33
R7697:Unc80 UTSW 1 66637945 missense possibly damaging 0.93
R7746:Unc80 UTSW 1 66677385 missense probably benign 0.33
R7768:Unc80 UTSW 1 66510595 missense possibly damaging 0.56
R7796:Unc80 UTSW 1 66503714 missense probably benign
R7855:Unc80 UTSW 1 66483349 missense possibly damaging 0.78
R7878:Unc80 UTSW 1 66601141 missense possibly damaging 0.88
R7879:Unc80 UTSW 1 66510707 missense probably benign 0.00
R8024:Unc80 UTSW 1 66606644 missense possibly damaging 0.86
R8026:Unc80 UTSW 1 66483304 missense possibly damaging 0.92
R8115:Unc80 UTSW 1 66648913 missense probably benign 0.00
R8135:Unc80 UTSW 1 66509287 missense possibly damaging 0.49
R8170:Unc80 UTSW 1 66651533 missense probably benign 0.33
R8239:Unc80 UTSW 1 66654019 missense probably benign
R8249:Unc80 UTSW 1 66619491 missense probably benign 0.01
R8275:Unc80 UTSW 1 66640614 nonsense probably null
R8288:Unc80 UTSW 1 66473350 missense probably benign 0.07
R8341:Unc80 UTSW 1 66649033 missense possibly damaging 0.73
R8356:Unc80 UTSW 1 66641629 missense possibly damaging 0.85
R8433:Unc80 UTSW 1 66638028 nonsense probably null
R8456:Unc80 UTSW 1 66641629 missense possibly damaging 0.85
R8464:Unc80 UTSW 1 66473264 missense probably damaging 1.00
R8483:Unc80 UTSW 1 66693710 missense possibly damaging 0.83
R8509:Unc80 UTSW 1 66641629 missense possibly damaging 0.85
R8686:Unc80 UTSW 1 66612268 missense possibly damaging 0.53
R8701:Unc80 UTSW 1 66638032 missense possibly damaging 0.85
R8729:Unc80 UTSW 1 66608490 missense probably benign 0.01
R8755:Unc80 UTSW 1 66612131 missense possibly damaging 0.53
R8771:Unc80 UTSW 1 66646395 missense possibly damaging 0.85
R8866:Unc80 UTSW 1 66590229 missense probably benign 0.05
R8877:Unc80 UTSW 1 66527985 missense possibly damaging 0.89
R8942:Unc80 UTSW 1 66473309 missense possibly damaging 0.94
R8976:Unc80 UTSW 1 66472010 missense possibly damaging 0.87
R9063:Unc80 UTSW 1 66606657 critical splice donor site probably null
R9095:Unc80 UTSW 1 66506753 missense probably damaging 1.00
R9125:Unc80 UTSW 1 66679581 missense probably benign 0.18
R9130:Unc80 UTSW 1 66638085 missense possibly damaging 0.85
R9165:Unc80 UTSW 1 66549841 missense probably null 0.95
R9220:Unc80 UTSW 1 66507375 missense probably damaging 1.00
R9334:Unc80 UTSW 1 66649760 missense possibly damaging 0.73
R9374:Unc80 UTSW 1 66590301 missense possibly damaging 0.95
R9387:Unc80 UTSW 1 66549938 critical splice donor site probably null
R9415:Unc80 UTSW 1 66510905 missense
R9427:Unc80 UTSW 1 66554999 missense probably damaging 1.00
R9436:Unc80 UTSW 1 66693805 critical splice donor site probably null
R9454:Unc80 UTSW 1 66695590 missense possibly damaging 0.53
R9522:Unc80 UTSW 1 66638062 missense possibly damaging 0.73
R9539:Unc80 UTSW 1 66570004 critical splice donor site probably null
R9552:Unc80 UTSW 1 66678123 missense possibly damaging 0.85
X0019:Unc80 UTSW 1 66648382 missense probably benign 0.33
X0021:Unc80 UTSW 1 66509266 critical splice acceptor site probably null
X0024:Unc80 UTSW 1 66491046 missense probably benign 0.21
X0062:Unc80 UTSW 1 66623259 missense probably benign 0.02
X0066:Unc80 UTSW 1 66530757 missense possibly damaging 0.77
Y4335:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Y4336:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Y4338:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Z1088:Unc80 UTSW 1 66646451 missense possibly damaging 0.85
Z1176:Unc80 UTSW 1 66694409 missense probably benign
Z1177:Unc80 UTSW 1 66646398 missense possibly damaging 0.72
Z1177:Unc80 UTSW 1 66695339 missense probably benign 0.03
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gctttgcctactatcaactccc -3'
Posted On 2013-07-11