Incidental Mutation 'R7405:Aire'
ID574520
Institutional Source Beutler Lab
Gene Symbol Aire
Ensembl Gene ENSMUSG00000000731
Gene Nameautoimmune regulator (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7405 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location78030022-78043610 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78034613 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 458 (H458R)
Ref Sequence ENSEMBL: ENSMUSP00000114904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019257] [ENSMUST00000105395] [ENSMUST00000105396] [ENSMUST00000128241] [ENSMUST00000130972] [ENSMUST00000131028] [ENSMUST00000140636] [ENSMUST00000143735] [ENSMUST00000145975] [ENSMUST00000148469] [ENSMUST00000154374] [ENSMUST00000155021] [ENSMUST00000156417]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019257
AA Change: H457R

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000019257
Gene: ENSMUSG00000000731
AA Change: H457R

DomainStartEndE-ValueType
Pfam:Sp100 1 107 8.9e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 299 342 6.75e-11 SMART
RING 300 341 3.63e0 SMART
low complexity region 398 419 N/A INTRINSIC
PHD 432 475 7.82e-7 SMART
RING 433 474 2.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105395
SMART Domains Protein: ENSMUSP00000101034
Gene: ENSMUSG00000000731

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 300 343 6.75e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105396
AA Change: H398R

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101035
Gene: ENSMUSG00000000731
AA Change: H398R

DomainStartEndE-ValueType
Pfam:Sp100 1 107 2.2e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 299 342 6.75e-11 SMART
RING 300 341 3.63e0 SMART
PHD 373 416 7.82e-7 SMART
RING 374 415 2.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128241
AA Change: H458R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000114904
Gene: ENSMUSG00000000731
AA Change: H458R

DomainStartEndE-ValueType
Pfam:Sp100 5 104 3.3e-27 PFAM
SAND 198 264 2.61e-26 SMART
PHD 300 343 6.75e-11 SMART
RING 301 342 3.63e0 SMART
low complexity region 399 420 N/A INTRINSIC
PHD 433 476 7.82e-7 SMART
RING 434 475 2.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130972
AA Change: H453R

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122659
Gene: ENSMUSG00000000731
AA Change: H453R

DomainStartEndE-ValueType
Pfam:Sp100 1 107 2.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 295 338 6.75e-11 SMART
RING 296 337 3.63e0 SMART
low complexity region 394 415 N/A INTRINSIC
PHD 428 471 7.82e-7 SMART
RING 429 470 2.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131028
SMART Domains Protein: ENSMUSP00000114808
Gene: ENSMUSG00000000731

DomainStartEndE-ValueType
Pfam:Sp100 5 57 2.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140636
SMART Domains Protein: ENSMUSP00000121477
Gene: ENSMUSG00000000731

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 295 338 6.75e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143735
SMART Domains Protein: ENSMUSP00000123678
Gene: ENSMUSG00000000731

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.1e-34 PFAM
SAND 198 264 2.61e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145975
AA Change: H454R

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000120150
Gene: ENSMUSG00000000731
AA Change: H454R

DomainStartEndE-ValueType
Pfam:Sp100 1 107 2.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 296 339 6.75e-11 SMART
RING 297 338 3.63e0 SMART
low complexity region 395 416 N/A INTRINSIC
PHD 429 472 7.82e-7 SMART
RING 430 471 2.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148469
SMART Domains Protein: ENSMUSP00000118317
Gene: ENSMUSG00000000731

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 296 339 6.75e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000154374
AA Change: H399R

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117094
Gene: ENSMUSG00000000731
AA Change: H399R

DomainStartEndE-ValueType
Pfam:Sp100 1 107 7.4e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 300 343 6.75e-11 SMART
RING 301 342 3.63e0 SMART
PHD 374 417 7.82e-7 SMART
RING 375 416 2.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155021
AA Change: H394R

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000122190
Gene: ENSMUSG00000000731
AA Change: H394R

DomainStartEndE-ValueType
Pfam:Sp100 1 107 2.2e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 295 338 6.75e-11 SMART
RING 296 337 3.63e0 SMART
PHD 369 412 7.82e-7 SMART
RING 370 411 2.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156417
SMART Domains Protein: ENSMUSP00000115162
Gene: ENSMUSG00000000731

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 299 342 6.75e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional regulator that forms nuclear bodies and interacts with the transcriptional coactivator CREB binding protein. The encoded protein plays an important role in immunity by regulating the expression of autoantigens and negative selection of autoreactive T-cells in the thymus. Mutations in this gene cause the rare autosomal-recessive systemic autoimmune disease termed autoimmune polyendocrinopathy with candidiasis and ectodermal dystrophy (APECED). [provided by RefSeq, Jun 2012]
PHENOTYPE: Targeted mutations that inactivate the gene result in immune system dysfunction characterized by multiorgan lymphocytic infiltration and circulating autoantibodies. Whereas one line is fertile, another exhibits male and female sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G T 17: 9,001,817 V383L probably damaging Het
1700012P22Rik T C 4: 144,419,753 N110S probably damaging Het
2410141K09Rik T C 13: 66,431,059 Q455R unknown Het
4930507D05Rik C A 10: 62,449,784 H96N unknown Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
5730480H06Rik T C 5: 48,388,116 I235T possibly damaging Het
Abcb11 A G 2: 69,287,619 Y472H probably damaging Het
Adam39 A T 8: 40,824,622 I17L probably benign Het
Ap3d1 T C 10: 80,741,900 D31G probably benign Het
Atad2b T A 12: 4,943,232 H250Q probably benign Het
Borcs5 C A 6: 134,685,982 T74N probably benign Het
Btbd16 C T 7: 130,805,856 T292I probably benign Het
Catsperd G A 17: 56,632,335 V55M possibly damaging Het
Ctr9 T C 7: 111,043,714 F462S possibly damaging Het
Cyp4f39 A G 17: 32,481,815 S153G probably benign Het
Ddo T C 10: 40,647,997 C328R possibly damaging Het
Ddr1 A G 17: 35,690,100 V251A probably damaging Het
Dis3l A G 9: 64,314,704 F475L probably damaging Het
Dkk4 G A 8: 22,625,843 V99M probably benign Het
Dync1h1 C T 12: 110,634,220 A1938V probably damaging Het
Ecel1 A T 1: 87,153,516 probably null Het
Fbxo7 T A 10: 86,044,581 Y377N probably damaging Het
Fbxw24 T C 9: 109,607,068 I299V possibly damaging Het
Fkbp10 C T 11: 100,415,881 A33V probably damaging Het
Gabra1 T C 11: 42,155,023 T87A probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm884 A T 11: 103,615,161 Y1994N probably benign Het
Golga3 A T 5: 110,208,446 I1000F probably damaging Het
Grid2ip T C 5: 143,380,444 I563T probably benign Het
Gsx1 T C 5: 147,189,133 S82P possibly damaging Het
Heg1 A G 16: 33,763,449 K34E possibly damaging Het
Kank1 T A 19: 25,410,319 L452* probably null Het
Lce1k A T 3: 92,806,874 M1K probably null Het
Lcmt2 A G 2: 121,139,387 I185T probably benign Het
Lrp1 T C 10: 127,581,751 D1046G possibly damaging Het
Mast3 A T 8: 70,786,171 D496E probably damaging Het
Mst1r C T 9: 107,915,122 S925F possibly damaging Het
Mterf2 C T 10: 85,120,496 G88D probably damaging Het
Mthfd1 T C 12: 76,311,874 V783A probably damaging Het
Mybpc2 A T 7: 44,507,194 W778R probably damaging Het
Nbea A G 3: 55,805,266 L2130P possibly damaging Het
Ndst4 A G 3: 125,683,216 N30S probably benign Het
Nphs1 T C 7: 30,462,828 V299A possibly damaging Het
Nup107 T C 10: 117,770,415 D474G probably benign Het
Olfr1118 A C 2: 87,308,995 I89L probably benign Het
Olfr1490 T C 19: 13,654,882 V151A probably benign Het
Olfr225 T A 11: 59,614,073 F370I possibly damaging Het
Olfr8 T C 10: 78,955,697 V164A probably benign Het
Pgap2 T C 7: 102,231,388 V41A probably benign Het
Plekhh1 C T 12: 79,055,047 T297I probably benign Het
Plxna4 A T 6: 32,196,319 Y1226N probably benign Het
Polr3b A G 10: 84,684,179 D653G probably benign Het
Ppp2r2c T C 5: 36,947,142 F289L possibly damaging Het
Prickle2 A G 6: 92,458,543 S82P probably damaging Het
Ptger2 T A 14: 44,989,074 V37D probably damaging Het
Rasa2 G A 9: 96,566,027 P526S probably benign Het
Rbm47 A T 5: 66,026,495 I255N probably damaging Het
Sez6 A T 11: 77,962,891 T296S probably benign Het
Slc2a9 T A 5: 38,391,824 I316F probably damaging Het
Slc41a1 T A 1: 131,839,146 V134D probably damaging Het
Slc5a7 A T 17: 54,297,133 S2T probably benign Het
Slc9a4 C T 1: 40,600,926 R293C probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Suco A G 1: 161,828,214 F1039L possibly damaging Het
Sycp1 A G 3: 102,925,227 Y208H possibly damaging Het
Tpr T C 1: 150,442,127 S2129P probably benign Het
Trim34b T A 7: 104,336,483 S442T probably damaging Het
Ttn A T 2: 76,743,346 Y25734* probably null Het
Uchl5 C T 1: 143,800,014 Q276* probably null Het
Wrn C G 8: 33,248,966 W1278S probably benign Het
Yeats2 T A 16: 20,222,913 D1184E probably damaging Het
Zfat G A 15: 68,184,485 R241W probably damaging Het
Zfp646 T A 7: 127,878,796 Y48* probably null Het
Other mutations in Aire
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:Aire APN 10 78036723 nonsense probably null
IGL01969:Aire APN 10 78042982 missense probably damaging 1.00
BB008:Aire UTSW 10 78030296 missense probably damaging 1.00
BB018:Aire UTSW 10 78030296 missense probably damaging 1.00
E0370:Aire UTSW 10 78042063 missense probably damaging 1.00
IGL03055:Aire UTSW 10 78043069 missense probably damaging 1.00
R0326:Aire UTSW 10 78042599 missense probably damaging 1.00
R0675:Aire UTSW 10 78034493 splice site probably benign
R1748:Aire UTSW 10 78043480 missense probably damaging 0.99
R1754:Aire UTSW 10 78030290 missense probably damaging 1.00
R2014:Aire UTSW 10 78042958 missense probably damaging 1.00
R2015:Aire UTSW 10 78042958 missense probably damaging 1.00
R3800:Aire UTSW 10 78042055 unclassified probably null
R5424:Aire UTSW 10 78036719 missense probably damaging 1.00
R5517:Aire UTSW 10 78039691 missense probably benign 0.14
R5983:Aire UTSW 10 78043069 missense probably damaging 1.00
R6135:Aire UTSW 10 78042967 missense probably damaging 1.00
R6856:Aire UTSW 10 78030255 missense probably damaging 1.00
R7484:Aire UTSW 10 78042570 missense probably damaging 1.00
R7606:Aire UTSW 10 78037933 missense probably damaging 1.00
R7931:Aire UTSW 10 78030296 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACACTGACCTTGGCAAGC -3'
(R):5'- GAGGTTTCCCAGTTAACCCG -3'

Sequencing Primer
(F):5'- TGACCTTGGCAAGCCCAGG -3'
(R):5'- TTCCCAGTTAACCCGGGCTG -3'
Posted On2019-09-13