Incidental Mutation 'R7405:Nup107'
ID574526
Institutional Source Beutler Lab
Gene Symbol Nup107
Ensembl Gene ENSMUSG00000052798
Gene Namenucleoporin 107
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R7405 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location117750621-117792705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117770415 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 474 (D474G)
Ref Sequence ENSEMBL: ENSMUSP00000063590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064848] [ENSMUST00000167943] [ENSMUST00000218576]
Predicted Effect probably benign
Transcript: ENSMUST00000064848
AA Change: D474G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000063590
Gene: ENSMUSG00000052798
AA Change: D474G

DomainStartEndE-ValueType
Pfam:Nup84_Nup100 210 909 2.2e-218 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167943
AA Change: D472G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000129546
Gene: ENSMUSG00000052798
AA Change: D472G

DomainStartEndE-ValueType
Pfam:Nup84_Nup100 206 909 2.4e-226 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218576
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleoporin family. The protein is localized to the nuclear rim and is an essential component of the nuclear pore complex (NPC). All molecules entering or leaving the nucleus either diffuse through or are actively transported by the NPC. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a CRISPR-generated allele exhibit reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G T 17: 9,001,817 V383L probably damaging Het
1700012P22Rik T C 4: 144,419,753 N110S probably damaging Het
2410141K09Rik T C 13: 66,431,059 Q455R unknown Het
4930507D05Rik C A 10: 62,449,784 H96N unknown Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
5730480H06Rik T C 5: 48,388,116 I235T possibly damaging Het
Abcb11 A G 2: 69,287,619 Y472H probably damaging Het
Adam39 A T 8: 40,824,622 I17L probably benign Het
Aire T C 10: 78,034,613 H458R probably benign Het
Ap3d1 T C 10: 80,741,900 D31G probably benign Het
Atad2b T A 12: 4,943,232 H250Q probably benign Het
Borcs5 C A 6: 134,685,982 T74N probably benign Het
Btbd16 C T 7: 130,805,856 T292I probably benign Het
Catsperd G A 17: 56,632,335 V55M possibly damaging Het
Ctr9 T C 7: 111,043,714 F462S possibly damaging Het
Cyp4f39 A G 17: 32,481,815 S153G probably benign Het
Ddo T C 10: 40,647,997 C328R possibly damaging Het
Ddr1 A G 17: 35,690,100 V251A probably damaging Het
Dis3l A G 9: 64,314,704 F475L probably damaging Het
Dkk4 G A 8: 22,625,843 V99M probably benign Het
Dync1h1 C T 12: 110,634,220 A1938V probably damaging Het
Ecel1 A T 1: 87,153,516 probably null Het
Fbxo7 T A 10: 86,044,581 Y377N probably damaging Het
Fbxw24 T C 9: 109,607,068 I299V possibly damaging Het
Fkbp10 C T 11: 100,415,881 A33V probably damaging Het
Gabra1 T C 11: 42,155,023 T87A probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm884 A T 11: 103,615,161 Y1994N probably benign Het
Golga3 A T 5: 110,208,446 I1000F probably damaging Het
Grid2ip T C 5: 143,380,444 I563T probably benign Het
Gsx1 T C 5: 147,189,133 S82P possibly damaging Het
Heg1 A G 16: 33,763,449 K34E possibly damaging Het
Kank1 T A 19: 25,410,319 L452* probably null Het
Lce1k A T 3: 92,806,874 M1K probably null Het
Lcmt2 A G 2: 121,139,387 I185T probably benign Het
Lrp1 T C 10: 127,581,751 D1046G possibly damaging Het
Mast3 A T 8: 70,786,171 D496E probably damaging Het
Mst1r C T 9: 107,915,122 S925F possibly damaging Het
Mterf2 C T 10: 85,120,496 G88D probably damaging Het
Mthfd1 T C 12: 76,311,874 V783A probably damaging Het
Mybpc2 A T 7: 44,507,194 W778R probably damaging Het
Nbea A G 3: 55,805,266 L2130P possibly damaging Het
Ndst4 A G 3: 125,683,216 N30S probably benign Het
Nphs1 T C 7: 30,462,828 V299A possibly damaging Het
Olfr1118 A C 2: 87,308,995 I89L probably benign Het
Olfr1490 T C 19: 13,654,882 V151A probably benign Het
Olfr225 T A 11: 59,614,073 F370I possibly damaging Het
Olfr8 T C 10: 78,955,697 V164A probably benign Het
Pgap2 T C 7: 102,231,388 V41A probably benign Het
Plekhh1 C T 12: 79,055,047 T297I probably benign Het
Plxna4 A T 6: 32,196,319 Y1226N probably benign Het
Polr3b A G 10: 84,684,179 D653G probably benign Het
Ppp2r2c T C 5: 36,947,142 F289L possibly damaging Het
Prickle2 A G 6: 92,458,543 S82P probably damaging Het
Ptger2 T A 14: 44,989,074 V37D probably damaging Het
Rasa2 G A 9: 96,566,027 P526S probably benign Het
Rbm47 A T 5: 66,026,495 I255N probably damaging Het
Sez6 A T 11: 77,962,891 T296S probably benign Het
Slc2a9 T A 5: 38,391,824 I316F probably damaging Het
Slc41a1 T A 1: 131,839,146 V134D probably damaging Het
Slc5a7 A T 17: 54,297,133 S2T probably benign Het
Slc9a4 C T 1: 40,600,926 R293C probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Suco A G 1: 161,828,214 F1039L possibly damaging Het
Sycp1 A G 3: 102,925,227 Y208H possibly damaging Het
Tpr T C 1: 150,442,127 S2129P probably benign Het
Trim34b T A 7: 104,336,483 S442T probably damaging Het
Ttn A T 2: 76,743,346 Y25734* probably null Het
Uchl5 C T 1: 143,800,014 Q276* probably null Het
Wrn C G 8: 33,248,966 W1278S probably benign Het
Yeats2 T A 16: 20,222,913 D1184E probably damaging Het
Zfat G A 15: 68,184,485 R241W probably damaging Het
Zfp646 T A 7: 127,878,796 Y48* probably null Het
Other mutations in Nup107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Nup107 APN 10 117763803 missense probably damaging 1.00
IGL00595:Nup107 APN 10 117773352 nonsense probably null
IGL00595:Nup107 APN 10 117773368 critical splice acceptor site probably null
IGL01120:Nup107 APN 10 117770241 splice site probably benign
IGL01420:Nup107 APN 10 117785021 missense probably damaging 1.00
IGL01646:Nup107 APN 10 117781342 missense probably damaging 1.00
IGL01748:Nup107 APN 10 117757274 missense probably benign 0.06
IGL01755:Nup107 APN 10 117774493 missense probably damaging 1.00
IGL01982:Nup107 APN 10 117759340 splice site probably benign
IGL03394:Nup107 APN 10 117782028 missense probably damaging 0.96
R0371:Nup107 UTSW 10 117763769 missense probably damaging 0.98
R1036:Nup107 UTSW 10 117757294 missense probably damaging 0.98
R1186:Nup107 UTSW 10 117777146 nonsense probably null
R1538:Nup107 UTSW 10 117790494 missense probably damaging 0.96
R1555:Nup107 UTSW 10 117751490 splice site probably benign
R1570:Nup107 UTSW 10 117763844 missense possibly damaging 0.49
R1758:Nup107 UTSW 10 117761343 missense probably damaging 1.00
R1856:Nup107 UTSW 10 117750906 missense probably damaging 1.00
R2105:Nup107 UTSW 10 117773320 missense probably damaging 1.00
R2127:Nup107 UTSW 10 117774475 missense possibly damaging 0.69
R4480:Nup107 UTSW 10 117761332 missense probably benign 0.00
R4540:Nup107 UTSW 10 117762020 splice site probably null
R4584:Nup107 UTSW 10 117766368 missense probably benign 0.05
R4878:Nup107 UTSW 10 117751418 missense probably benign 0.17
R4887:Nup107 UTSW 10 117770478 missense probably damaging 1.00
R4921:Nup107 UTSW 10 117770511 missense possibly damaging 0.95
R5960:Nup107 UTSW 10 117790010 missense probably null
R5986:Nup107 UTSW 10 117759176 missense probably damaging 1.00
R6947:Nup107 UTSW 10 117757274 missense probably benign 0.06
R7092:Nup107 UTSW 10 117790494 missense probably damaging 0.96
R7165:Nup107 UTSW 10 117773362 missense probably damaging 0.98
R7190:Nup107 UTSW 10 117762135 missense probably benign
R7331:Nup107 UTSW 10 117770198 missense probably damaging 0.99
R7596:Nup107 UTSW 10 117777160 missense probably damaging 1.00
R7644:Nup107 UTSW 10 117770470 missense probably damaging 1.00
R7734:Nup107 UTSW 10 117758012 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTAAGGTCCAACTTCAAAAGAGG -3'
(R):5'- AGTGTCCCCTGTCATCAGAAG -3'

Sequencing Primer
(F):5'- ACAGAGATGACCACCTGAG -3'
(R):5'- CATCAGAAGATGGCTTTTGAAGTTTG -3'
Posted On2019-09-13