Mutagenetix > Incidental Mutation

Incidental Mutation 'R7405:Sez6'

574530

Institutional Source

Beutler Lab

Gene Symbol

Sez6

Ensembl Gene

ENSMUSG00000000632

Gene Name

seizure related gene 6

Synonyms

D11Bhm177e, sez-6

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7405 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

77930800-77979048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 77962891 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 296 (T296S)

Ref Sequence

ENSEMBL: ENSMUSP00000091532 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000646] [ENSMUST00000093995]

AlphaFold

Q7TSK2

Predicted Effect

probably benign
Transcript: ENSMUST00000000646
AA Change: T296S

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000000646
Gene: ENSMUSG00000000632
AA Change: T296S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	72	85	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
low complexity region	223	235	N/A	INTRINSIC
CUB	241	350	9.36e-2	SMART
CCP	354	409	1.23e-10	SMART
CUB	413	524	1.41e-28	SMART
CCP	529	586	5.43e-12	SMART
CUB	590	701	7.49e-24	SMART
CCP	707	762	3.09e-16	SMART
CCP	768	827	3.5e-15	SMART
CCP	835	892	1.42e-15	SMART
transmembrane domain	910	932	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000093995
AA Change: T296S

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000091532
Gene: ENSMUSG00000000632
AA Change: T296S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	72	85	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
low complexity region	223	235	N/A	INTRINSIC
CUB	241	350	9.36e-2	SMART
CCP	354	409	1.23e-10	SMART
CUB	413	524	1.41e-28	SMART
CCP	529	586	5.43e-12	SMART
CUB	590	701	7.49e-24	SMART
CCP	707	762	3.09e-16	SMART
CCP	768	827	3.5e-15	SMART
CCP	835	892	1.42e-15	SMART
transmembrane domain	923	945	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000132041
Gene: ENSMUSG00000000632
AA Change: T129S

Domain	Start	End	E-Value	Type
low complexity region	57	69	N/A	INTRINSIC
CUB	75	184	9.36e-2	SMART
CCP	188	243	1.23e-10	SMART
CUB	247	358	8.08e-29	SMART
low complexity region	379	394	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain five cysteine-rich motifs that are similar to sushi domains, as well as two domains similar to the amino terminal half of the CUB (for complement C1r/C1s, Uegf, Bmp1) domain. Mutations in this gene have been associated with febrile seizures. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit increased short dendrites, decreased excitatory synaptic signaling, resistance to pharmacologically induces seizures, decreased activity and impaired learning and coordination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	G	T	17: 9,001,817	V383L	probably damaging	Het
1700012P22Rik	T	C	4: 144,419,753	N110S	probably damaging	Het
2410141K09Rik	T	C	13: 66,431,059	Q455R	unknown	Het
4930507D05Rik	C	A	10: 62,449,784	H96N	unknown	Het
4930539E08Rik	G	A	17: 28,905,324	R335W	probably damaging	Het
5730480H06Rik	T	C	5: 48,388,116	I235T	possibly damaging	Het
Abcb11	A	G	2: 69,287,619	Y472H	probably damaging	Het
Adam39	A	T	8: 40,824,622	I17L	probably benign	Het
Aire	T	C	10: 78,034,613	H458R	probably benign	Het
Ap3d1	T	C	10: 80,741,900	D31G	probably benign	Het
Atad2b	T	A	12: 4,943,232	H250Q	probably benign	Het
Borcs5	C	A	6: 134,685,982	T74N	probably benign	Het
Btbd16	C	T	7: 130,805,856	T292I	probably benign	Het
Catsperd	G	A	17: 56,632,335	V55M	possibly damaging	Het
Ctr9	T	C	7: 111,043,714	F462S	possibly damaging	Het
Cyp4f39	A	G	17: 32,481,815	S153G	probably benign	Het
Ddo	T	C	10: 40,647,997	C328R	possibly damaging	Het
Ddr1	A	G	17: 35,690,100	V251A	probably damaging	Het
Dis3l	A	G	9: 64,314,704	F475L	probably damaging	Het
Dkk4	G	A	8: 22,625,843	V99M	probably benign	Het
Dync1h1	C	T	12: 110,634,220	A1938V	probably damaging	Het
Ecel1	A	T	1: 87,153,516		probably null	Het
Fbxo7	T	A	10: 86,044,581	Y377N	probably damaging	Het
Fbxw24	T	C	9: 109,607,068	I299V	possibly damaging	Het
Fkbp10	C	T	11: 100,415,881	A33V	probably damaging	Het
Gabra1	T	C	11: 42,155,023	T87A	probably damaging	Het
Gm21886	ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG	ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG	18: 80,089,825		probably benign	Het
Gm884	A	T	11: 103,615,161	Y1994N	probably benign	Het
Golga3	A	T	5: 110,208,446	I1000F	probably damaging	Het
Grid2ip	T	C	5: 143,380,444	I563T	probably benign	Het
Gsx1	T	C	5: 147,189,133	S82P	possibly damaging	Het
Heg1	A	G	16: 33,763,449	K34E	possibly damaging	Het
Kank1	T	A	19: 25,410,319	L452*	probably null	Het
Lce1k	A	T	3: 92,806,874	M1K	probably null	Het
Lcmt2	A	G	2: 121,139,387	I185T	probably benign	Het
Lrp1	T	C	10: 127,581,751	D1046G	possibly damaging	Het
Mast3	A	T	8: 70,786,171	D496E	probably damaging	Het
Mst1r	C	T	9: 107,915,122	S925F	possibly damaging	Het
Mterf2	C	T	10: 85,120,496	G88D	probably damaging	Het
Mthfd1	T	C	12: 76,311,874	V783A	probably damaging	Het
Mybpc2	A	T	7: 44,507,194	W778R	probably damaging	Het
Nbea	A	G	3: 55,805,266	L2130P	possibly damaging	Het
Ndst4	A	G	3: 125,683,216	N30S	probably benign	Het
Nphs1	T	C	7: 30,462,828	V299A	possibly damaging	Het
Nup107	T	C	10: 117,770,415	D474G	probably benign	Het
Olfr1118	A	C	2: 87,308,995	I89L	probably benign	Het
Olfr1490	T	C	19: 13,654,882	V151A	probably benign	Het
Olfr225	T	A	11: 59,614,073	F370I	possibly damaging	Het
Olfr8	T	C	10: 78,955,697	V164A	probably benign	Het
Pgap2	T	C	7: 102,231,388	V41A	probably benign	Het
Plekhh1	C	T	12: 79,055,047	T297I	probably benign	Het
Plxna4	A	T	6: 32,196,319	Y1226N	probably benign	Het
Polr3b	A	G	10: 84,684,179	D653G	probably benign	Het
Ppp2r2c	T	C	5: 36,947,142	F289L	possibly damaging	Het
Prickle2	A	G	6: 92,458,543	S82P	probably damaging	Het
Ptger2	T	A	14: 44,989,074	V37D	probably damaging	Het
Rasa2	G	A	9: 96,566,027	P526S	probably benign	Het
Rbm47	A	T	5: 66,026,495	I255N	probably damaging	Het
Slc2a9	T	A	5: 38,391,824	I316F	probably damaging	Het
Slc41a1	T	A	1: 131,839,146	V134D	probably damaging	Het
Slc5a7	A	T	17: 54,297,133	S2T	probably benign	Het
Slc9a4	C	T	1: 40,600,926	R293C	probably damaging	Het
Son	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	16: 91,656,691		probably benign	Het
Suco	A	G	1: 161,828,214	F1039L	possibly damaging	Het
Sycp1	A	G	3: 102,925,227	Y208H	possibly damaging	Het
Tpr	T	C	1: 150,442,127	S2129P	probably benign	Het
Trim34b	T	A	7: 104,336,483	S442T	probably damaging	Het
Ttn	A	T	2: 76,743,346	Y25734*	probably null	Het
Uchl5	C	T	1: 143,800,014	Q276*	probably null	Het
Wrn	C	G	8: 33,248,966	W1278S	probably benign	Het
Yeats2	T	A	16: 20,222,913	D1184E	probably damaging	Het
Zfat	G	A	15: 68,184,485	R241W	probably damaging	Het
Zfp646	T	A	7: 127,878,796	Y48*	probably null	Het

Other mutations in Sez6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01125:Sez6	APN	11	77977289	splice site	probably benign
IGL01142:Sez6	APN	11	77973816	missense	probably damaging	1.00
IGL02252:Sez6	APN	11	77974513	missense	probably damaging	1.00
IGL02332:Sez6	APN	11	77954742	splice site	probably benign
IGL02366:Sez6	APN	11	77976882	missense	probably damaging	0.98
IGL02479:Sez6	APN	11	77978026	missense	possibly damaging	0.84
IGL02963:Sez6	APN	11	77962949	missense	possibly damaging	0.93
velum	UTSW	11	77974549	missense	probably damaging	1.00
R0054:Sez6	UTSW	11	77953873	missense	possibly damaging	0.94
R0054:Sez6	UTSW	11	77953873	missense	possibly damaging	0.94
R0089:Sez6	UTSW	11	77974344	splice site	probably benign
R0485:Sez6	UTSW	11	77953813	missense	probably damaging	1.00
R0598:Sez6	UTSW	11	77977821	missense	possibly damaging	0.88
R0729:Sez6	UTSW	11	77976585	missense	probably benign	0.01
R1117:Sez6	UTSW	11	77974514	missense	probably damaging	1.00
R1199:Sez6	UTSW	11	77953885	missense	probably benign
R1534:Sez6	UTSW	11	77963045	missense	probably damaging	1.00
R1835:Sez6	UTSW	11	77953503	missense	probably benign
R1840:Sez6	UTSW	11	77953717	missense	possibly damaging	0.79
R1929:Sez6	UTSW	11	77972932	missense	probably damaging	1.00
R1970:Sez6	UTSW	11	77954068	critical splice donor site	probably null
R3156:Sez6	UTSW	11	77953779	missense	possibly damaging	0.63
R3930:Sez6	UTSW	11	77976882	missense	probably damaging	0.98
R3931:Sez6	UTSW	11	77976882	missense	probably damaging	0.98
R4894:Sez6	UTSW	11	77975260	missense	probably damaging	1.00
R4904:Sez6	UTSW	11	77975254	missense	probably damaging	1.00
R5026:Sez6	UTSW	11	77968989	missense	probably damaging	1.00
R5040:Sez6	UTSW	11	77969089	critical splice donor site	probably null
R5057:Sez6	UTSW	11	77973153	missense	probably damaging	1.00
R5093:Sez6	UTSW	11	77976562	missense	possibly damaging	0.88
R5640:Sez6	UTSW	11	77973759	intron	probably benign
R6013:Sez6	UTSW	11	77973797	missense	probably damaging	1.00
R6126:Sez6	UTSW	11	77973804	missense	probably damaging	1.00
R6153:Sez6	UTSW	11	77977822	missense	probably damaging	0.99
R6279:Sez6	UTSW	11	77976541	missense	possibly damaging	0.63
R6300:Sez6	UTSW	11	77976541	missense	possibly damaging	0.63
R6475:Sez6	UTSW	11	77973844
R6722:Sez6	UTSW	11	77953702	missense	probably damaging	1.00
R6897:Sez6	UTSW	11	77953559	missense	probably damaging	1.00
R6910:Sez6	UTSW	11	77953869	missense	possibly damaging	0.85
R7012:Sez6	UTSW	11	77977795	missense	probably benign	0.04
R7233:Sez6	UTSW	11	77973137	missense	probably damaging	1.00
R7265:Sez6	UTSW	11	77962865	missense	probably damaging	0.96
R7289:Sez6	UTSW	11	77974323	missense	possibly damaging	0.96
R7408:Sez6	UTSW	11	77953530	missense	probably damaging	1.00
R7485:Sez6	UTSW	11	77973885	missense	probably benign	0.01
R7592:Sez6	UTSW	11	77978050	missense	probably damaging	0.99
R7778:Sez6	UTSW	11	77974549	missense	probably damaging	1.00
R7793:Sez6	UTSW	11	77977600	missense	probably damaging	1.00
R7818:Sez6	UTSW	11	77976902	missense	probably damaging	1.00
R7824:Sez6	UTSW	11	77974549	missense	probably damaging	1.00
R7980:Sez6	UTSW	11	77953842	missense	probably benign	0.34
R8008:Sez6	UTSW	11	77973256	nonsense	probably null
R8840:Sez6	UTSW	11	77976487	missense	probably damaging	1.00
R8947:Sez6	UTSW	11	77953527	missense	probably damaging	1.00
R8973:Sez6	UTSW	11	77974571	missense	probably damaging	1.00
R9040:Sez6	UTSW	11	77973936	missense	probably benign
R9081:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9082:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9092:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9094:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9095:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9097:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9169:Sez6	UTSW	11	77977647	missense	probably damaging	0.96
R9513:Sez6	UTSW	11	77974583	missense	probably damaging	1.00
R9630:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9632:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9646:Sez6	UTSW	11	77976806	missense	probably damaging	0.99
R9709:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
X0013:Sez6	UTSW	11	77954780	missense	probably benign	0.01
X0067:Sez6	UTSW	11	77974438	critical splice acceptor site	probably null
Z1088:Sez6	UTSW	11	77973197	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CTCTTCCTGTGTGAAGTGCCTAG -3'
(R):5'- GTGAGGACATCAAAGCCACC -3'

Sequencing Primer
(F):5'- GAAGTGCCTAGTTTGGGGAC -3'
(R):5'- CCCAGGAGAGTAGCCAGTCATG -3'

Posted On

2019-09-13