Incidental Mutation 'R7405:Ddr1'
ID574546
Institutional Source Beutler Lab
Gene Symbol Ddr1
Ensembl Gene ENSMUSG00000003534
Gene Namediscoidin domain receptor family, member 1
SynonymsCak, CD167a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.881) question?
Stock #R7405 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location35681567-35704621 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35690100 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 251 (V251A)
Ref Sequence ENSEMBL: ENSMUSP00000003628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003628] [ENSMUST00000097333] [ENSMUST00000117301] [ENSMUST00000119825] [ENSMUST00000134995] [ENSMUST00000135078] [ENSMUST00000145900] [ENSMUST00000146472] [ENSMUST00000148065] [ENSMUST00000155628] [ENSMUST00000155957] [ENSMUST00000166980]
Predicted Effect probably damaging
Transcript: ENSMUST00000003628
AA Change: V251A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003628
Gene: ENSMUSG00000003534
AA Change: V251A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 1.3e-36 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 548 565 N/A INTRINSIC
TyrKc 608 903 3.9e-131 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097333
AA Change: V251A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094945
Gene: ENSMUSG00000003534
AA Change: V251A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 511 528 N/A INTRINSIC
TyrKc 571 866 8.14e-129 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117301
AA Change: V251A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112570
Gene: ENSMUSG00000003534
AA Change: V251A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 1.3e-36 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 548 565 N/A INTRINSIC
TyrKc 608 903 4e-131 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119825
AA Change: V251A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113062
Gene: ENSMUSG00000003534
AA Change: V251A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 1.3e-36 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 548 565 N/A INTRINSIC
TyrKc 608 903 3.9e-131 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000134995
AA Change: V251A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117301
Gene: ENSMUSG00000003534
AA Change: V251A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
low complexity region 218 236 N/A INTRINSIC
Blast:FA58C 239 264 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000135078
SMART Domains Protein: ENSMUSP00000122191
Gene: ENSMUSG00000003534

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4AG4|A 30 89 5e-22 PDB
Blast:FA58C 31 89 6e-25 BLAST
SCOP:d1d7pm_ 32 78 5e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145900
SMART Domains Protein: ENSMUSP00000122361
Gene: ENSMUSG00000003534

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146472
SMART Domains Protein: ENSMUSP00000119397
Gene: ENSMUSG00000003534

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148065
AA Change: V121A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120635
Gene: ENSMUSG00000003534
AA Change: V121A

DomainStartEndE-ValueType
Blast:FA58C 1 56 2e-33 BLAST
SCOP:d1d7pm_ 1 58 2e-11 SMART
PDB:4AG4|A 1 143 3e-73 PDB
Blast:FA58C 109 143 1e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000155628
AA Change: V251A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133659
Gene: ENSMUSG00000003534
AA Change: V251A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
low complexity region 218 236 N/A INTRINSIC
Blast:FA58C 239 319 1e-45 BLAST
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 511 528 N/A INTRINSIC
PDB:4CKR|A 562 584 3e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000155957
AA Change: S217P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117427
Gene: ENSMUSG00000003534
AA Change: S217P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
low complexity region 192 209 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166980
AA Change: V251A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133047
Gene: ENSMUSG00000003534
AA Change: V251A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 1.3e-36 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 548 565 N/A INTRINSIC
TyrKc 608 903 3.9e-131 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Receptor tyrosine kinases play a key role in the communication of cells with their microenvironment. These kinases are involved in the regulation of cell growth, differentiation and metabolism. The protein encoded by this gene belongs to a subfamily of tyrosine kinase receptors with homology to Dictyostelium discoideum protein discoidin I in their extracellular domain, and that are activated by various types of collagen. Expression of this protein is restricted to epithelial cells, particularly in the kidney, lung, gastrointestinal tract, and brain. In addition, it has been shown to be significantly overexpressed in several human tumors. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous mutant mice are viable but smaller than control mice. Most mutant females are not able to give birth because developing blastocysts fail to implant. Successfully reproducing females show a lactation defect which is attributed to hyperproliferation and aberrant branching of mammary ducts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G T 17: 9,001,817 V383L probably damaging Het
1700012P22Rik T C 4: 144,419,753 N110S probably damaging Het
2410141K09Rik T C 13: 66,431,059 Q455R unknown Het
4930507D05Rik C A 10: 62,449,784 H96N unknown Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
5730480H06Rik T C 5: 48,388,116 I235T possibly damaging Het
Abcb11 A G 2: 69,287,619 Y472H probably damaging Het
Adam39 A T 8: 40,824,622 I17L probably benign Het
Aire T C 10: 78,034,613 H458R probably benign Het
Ap3d1 T C 10: 80,741,900 D31G probably benign Het
Atad2b T A 12: 4,943,232 H250Q probably benign Het
Borcs5 C A 6: 134,685,982 T74N probably benign Het
Btbd16 C T 7: 130,805,856 T292I probably benign Het
Catsperd G A 17: 56,632,335 V55M possibly damaging Het
Ctr9 T C 7: 111,043,714 F462S possibly damaging Het
Cyp4f39 A G 17: 32,481,815 S153G probably benign Het
Ddo T C 10: 40,647,997 C328R possibly damaging Het
Dis3l A G 9: 64,314,704 F475L probably damaging Het
Dkk4 G A 8: 22,625,843 V99M probably benign Het
Dync1h1 C T 12: 110,634,220 A1938V probably damaging Het
Ecel1 A T 1: 87,153,516 probably null Het
Fbxo7 T A 10: 86,044,581 Y377N probably damaging Het
Fbxw24 T C 9: 109,607,068 I299V possibly damaging Het
Fkbp10 C T 11: 100,415,881 A33V probably damaging Het
Gabra1 T C 11: 42,155,023 T87A probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm884 A T 11: 103,615,161 Y1994N probably benign Het
Golga3 A T 5: 110,208,446 I1000F probably damaging Het
Grid2ip T C 5: 143,380,444 I563T probably benign Het
Gsx1 T C 5: 147,189,133 S82P possibly damaging Het
Heg1 A G 16: 33,763,449 K34E possibly damaging Het
Kank1 T A 19: 25,410,319 L452* probably null Het
Lce1k A T 3: 92,806,874 M1K probably null Het
Lcmt2 A G 2: 121,139,387 I185T probably benign Het
Lrp1 T C 10: 127,581,751 D1046G possibly damaging Het
Mast3 A T 8: 70,786,171 D496E probably damaging Het
Mst1r C T 9: 107,915,122 S925F possibly damaging Het
Mterf2 C T 10: 85,120,496 G88D probably damaging Het
Mthfd1 T C 12: 76,311,874 V783A probably damaging Het
Mybpc2 A T 7: 44,507,194 W778R probably damaging Het
Nbea A G 3: 55,805,266 L2130P possibly damaging Het
Ndst4 A G 3: 125,683,216 N30S probably benign Het
Nphs1 T C 7: 30,462,828 V299A possibly damaging Het
Nup107 T C 10: 117,770,415 D474G probably benign Het
Olfr1118 A C 2: 87,308,995 I89L probably benign Het
Olfr1490 T C 19: 13,654,882 V151A probably benign Het
Olfr225 T A 11: 59,614,073 F370I possibly damaging Het
Olfr8 T C 10: 78,955,697 V164A probably benign Het
Pgap2 T C 7: 102,231,388 V41A probably benign Het
Plekhh1 C T 12: 79,055,047 T297I probably benign Het
Plxna4 A T 6: 32,196,319 Y1226N probably benign Het
Polr3b A G 10: 84,684,179 D653G probably benign Het
Ppp2r2c T C 5: 36,947,142 F289L possibly damaging Het
Prickle2 A G 6: 92,458,543 S82P probably damaging Het
Ptger2 T A 14: 44,989,074 V37D probably damaging Het
Rasa2 G A 9: 96,566,027 P526S probably benign Het
Rbm47 A T 5: 66,026,495 I255N probably damaging Het
Sez6 A T 11: 77,962,891 T296S probably benign Het
Slc2a9 T A 5: 38,391,824 I316F probably damaging Het
Slc41a1 T A 1: 131,839,146 V134D probably damaging Het
Slc5a7 A T 17: 54,297,133 S2T probably benign Het
Slc9a4 C T 1: 40,600,926 R293C probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Suco A G 1: 161,828,214 F1039L possibly damaging Het
Sycp1 A G 3: 102,925,227 Y208H possibly damaging Het
Tpr T C 1: 150,442,127 S2129P probably benign Het
Trim34b T A 7: 104,336,483 S442T probably damaging Het
Ttn A T 2: 76,743,346 Y25734* probably null Het
Uchl5 C T 1: 143,800,014 Q276* probably null Het
Wrn C G 8: 33,248,966 W1278S probably benign Het
Yeats2 T A 16: 20,222,913 D1184E probably damaging Het
Zfat G A 15: 68,184,485 R241W probably damaging Het
Zfp646 T A 7: 127,878,796 Y48* probably null Het
Other mutations in Ddr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02021:Ddr1 APN 17 35683480 missense probably damaging 1.00
IGL02126:Ddr1 APN 17 35688589 missense probably damaging 0.99
IGL02167:Ddr1 APN 17 35690071 missense possibly damaging 0.55
IGL02250:Ddr1 APN 17 35683480 missense probably damaging 1.00
IGL02251:Ddr1 APN 17 35683480 missense probably damaging 1.00
IGL02367:Ddr1 APN 17 35683480 missense probably damaging 1.00
PIT4449001:Ddr1 UTSW 17 35687249 missense possibly damaging 0.54
R0538:Ddr1 UTSW 17 35685007 missense probably damaging 1.00
R0674:Ddr1 UTSW 17 35689669 nonsense probably null
R4829:Ddr1 UTSW 17 35685113 missense probably damaging 1.00
R4940:Ddr1 UTSW 17 35690130 missense probably damaging 1.00
R5085:Ddr1 UTSW 17 35682775 critical splice acceptor site probably null
R5112:Ddr1 UTSW 17 35682485 missense probably benign
R5124:Ddr1 UTSW 17 35683597 missense probably damaging 1.00
R5652:Ddr1 UTSW 17 35686508 missense probably benign
R5653:Ddr1 UTSW 17 35686508 missense probably benign
R5654:Ddr1 UTSW 17 35686508 missense probably benign
R6427:Ddr1 UTSW 17 35687222 missense probably benign
R7226:Ddr1 UTSW 17 35691147 missense possibly damaging 0.94
R7534:Ddr1 UTSW 17 35682622 critical splice donor site probably null
R7568:Ddr1 UTSW 17 35684282 missense probably damaging 1.00
R8010:Ddr1 UTSW 17 35691492 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCCCAGAGTGTGCATGTTGTTAC -3'
(R):5'- AGTGAGAATCGGGCTTCCAG -3'

Sequencing Primer
(F):5'- GCATGTTGTTACAGTGGACC -3'
(R):5'- AGGCCGCTGCTGGATGTG -3'
Posted On2019-09-13