Incidental Mutation 'R7405:Catsperd'
ID574548
Institutional Source Beutler Lab
Gene Symbol Catsperd
Ensembl Gene ENSMUSG00000040828
Gene Namecation channel sperm associated auxiliary subunit delta
Synonyms4933402B14Rik, 4921529N20Rik, Gm6095, Tmem146
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7405 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location56628143-56664456 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56632335 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 55 (V55M)
Ref Sequence ENSEMBL: ENSMUSP00000108603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112979]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112979
AA Change: V55M

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108603
Gene: ENSMUSG00000040828
AA Change: V55M

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:CATSPERD 38 766 N/A PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a deletion in this gene display male infertility. Hyperactivity of sperm fails to develop under capacitating conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G T 17: 9,001,817 V383L probably damaging Het
1700012P22Rik T C 4: 144,419,753 N110S probably damaging Het
2410141K09Rik T C 13: 66,431,059 Q455R unknown Het
4930507D05Rik C A 10: 62,449,784 H96N unknown Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
5730480H06Rik T C 5: 48,388,116 I235T possibly damaging Het
Abcb11 A G 2: 69,287,619 Y472H probably damaging Het
Adam39 A T 8: 40,824,622 I17L probably benign Het
Aire T C 10: 78,034,613 H458R probably benign Het
Ap3d1 T C 10: 80,741,900 D31G probably benign Het
Atad2b T A 12: 4,943,232 H250Q probably benign Het
Borcs5 C A 6: 134,685,982 T74N probably benign Het
Btbd16 C T 7: 130,805,856 T292I probably benign Het
Ctr9 T C 7: 111,043,714 F462S possibly damaging Het
Cyp4f39 A G 17: 32,481,815 S153G probably benign Het
Ddo T C 10: 40,647,997 C328R possibly damaging Het
Ddr1 A G 17: 35,690,100 V251A probably damaging Het
Dis3l A G 9: 64,314,704 F475L probably damaging Het
Dkk4 G A 8: 22,625,843 V99M probably benign Het
Dync1h1 C T 12: 110,634,220 A1938V probably damaging Het
Ecel1 A T 1: 87,153,516 probably null Het
Fbxo7 T A 10: 86,044,581 Y377N probably damaging Het
Fbxw24 T C 9: 109,607,068 I299V possibly damaging Het
Fkbp10 C T 11: 100,415,881 A33V probably damaging Het
Gabra1 T C 11: 42,155,023 T87A probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm884 A T 11: 103,615,161 Y1994N probably benign Het
Golga3 A T 5: 110,208,446 I1000F probably damaging Het
Grid2ip T C 5: 143,380,444 I563T probably benign Het
Gsx1 T C 5: 147,189,133 S82P possibly damaging Het
Heg1 A G 16: 33,763,449 K34E possibly damaging Het
Kank1 T A 19: 25,410,319 L452* probably null Het
Lce1k A T 3: 92,806,874 M1K probably null Het
Lcmt2 A G 2: 121,139,387 I185T probably benign Het
Lrp1 T C 10: 127,581,751 D1046G possibly damaging Het
Mast3 A T 8: 70,786,171 D496E probably damaging Het
Mst1r C T 9: 107,915,122 S925F possibly damaging Het
Mterf2 C T 10: 85,120,496 G88D probably damaging Het
Mthfd1 T C 12: 76,311,874 V783A probably damaging Het
Mybpc2 A T 7: 44,507,194 W778R probably damaging Het
Nbea A G 3: 55,805,266 L2130P possibly damaging Het
Ndst4 A G 3: 125,683,216 N30S probably benign Het
Nphs1 T C 7: 30,462,828 V299A possibly damaging Het
Nup107 T C 10: 117,770,415 D474G probably benign Het
Olfr1118 A C 2: 87,308,995 I89L probably benign Het
Olfr1490 T C 19: 13,654,882 V151A probably benign Het
Olfr225 T A 11: 59,614,073 F370I possibly damaging Het
Olfr8 T C 10: 78,955,697 V164A probably benign Het
Pgap2 T C 7: 102,231,388 V41A probably benign Het
Plekhh1 C T 12: 79,055,047 T297I probably benign Het
Plxna4 A T 6: 32,196,319 Y1226N probably benign Het
Polr3b A G 10: 84,684,179 D653G probably benign Het
Ppp2r2c T C 5: 36,947,142 F289L possibly damaging Het
Prickle2 A G 6: 92,458,543 S82P probably damaging Het
Ptger2 T A 14: 44,989,074 V37D probably damaging Het
Rasa2 G A 9: 96,566,027 P526S probably benign Het
Rbm47 A T 5: 66,026,495 I255N probably damaging Het
Sez6 A T 11: 77,962,891 T296S probably benign Het
Slc2a9 T A 5: 38,391,824 I316F probably damaging Het
Slc41a1 T A 1: 131,839,146 V134D probably damaging Het
Slc5a7 A T 17: 54,297,133 S2T probably benign Het
Slc9a4 C T 1: 40,600,926 R293C probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Suco A G 1: 161,828,214 F1039L possibly damaging Het
Sycp1 A G 3: 102,925,227 Y208H possibly damaging Het
Tpr T C 1: 150,442,127 S2129P probably benign Het
Trim34b T A 7: 104,336,483 S442T probably damaging Het
Ttn A T 2: 76,743,346 Y25734* probably null Het
Uchl5 C T 1: 143,800,014 Q276* probably null Het
Wrn C G 8: 33,248,966 W1278S probably benign Het
Yeats2 T A 16: 20,222,913 D1184E probably damaging Het
Zfat G A 15: 68,184,485 R241W probably damaging Het
Zfp646 T A 7: 127,878,796 Y48* probably null Het
Other mutations in Catsperd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02514:Catsperd APN 17 56661271 missense probably damaging 0.98
IGL02598:Catsperd APN 17 56647815 splice site probably null
IGL03037:Catsperd APN 17 56641583 missense possibly damaging 0.80
IGL03330:Catsperd APN 17 56632316 missense possibly damaging 0.45
R0391:Catsperd UTSW 17 56662821 missense probably benign 0.00
R0463:Catsperd UTSW 17 56659554 missense probably damaging 0.99
R0506:Catsperd UTSW 17 56658078 missense possibly damaging 0.95
R0538:Catsperd UTSW 17 56662828 missense probably benign 0.00
R0550:Catsperd UTSW 17 56663427 critical splice donor site probably null
R1503:Catsperd UTSW 17 56654525 missense possibly damaging 0.63
R1705:Catsperd UTSW 17 56633521 missense probably damaging 0.97
R1919:Catsperd UTSW 17 56635548 missense probably damaging 0.99
R2851:Catsperd UTSW 17 56660169 critical splice acceptor site probably null
R2852:Catsperd UTSW 17 56660169 critical splice acceptor site probably null
R3147:Catsperd UTSW 17 56664039 missense possibly damaging 0.86
R3148:Catsperd UTSW 17 56664039 missense possibly damaging 0.86
R4084:Catsperd UTSW 17 56654453 missense probably benign 0.14
R4329:Catsperd UTSW 17 56654517 missense possibly damaging 0.80
R4940:Catsperd UTSW 17 56662736 missense possibly damaging 0.95
R4944:Catsperd UTSW 17 56662744 missense probably damaging 0.97
R4952:Catsperd UTSW 17 56632303 missense probably damaging 0.99
R5079:Catsperd UTSW 17 56658153 critical splice donor site probably null
R5259:Catsperd UTSW 17 56660235 missense possibly damaging 0.93
R5635:Catsperd UTSW 17 56632335 missense possibly damaging 0.95
R5929:Catsperd UTSW 17 56652493 missense probably benign 0.00
R6789:Catsperd UTSW 17 56654426 splice site probably null
R6909:Catsperd UTSW 17 56650781 missense probably damaging 0.96
R6920:Catsperd UTSW 17 56655175 nonsense probably null
R7099:Catsperd UTSW 17 56628811 intron probably null
R7106:Catsperd UTSW 17 56658070 splice site probably null
R7371:Catsperd UTSW 17 56650801 missense probably benign 0.22
R7478:Catsperd UTSW 17 56664055 missense probably benign 0.00
R7781:Catsperd UTSW 17 56664072 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAGGTTGGTTTCTAGCGT -3'
(R):5'- TGTGGGCCAGAGCTACTTG -3'

Sequencing Primer
(F):5'- AGCGTTTTCTTTCTGTTCTCCTGAG -3'
(R):5'- TTTAATCCCAGCACTCGGGAG -3'
Posted On2019-09-13