Incidental Mutation 'R7405:Olfr1490'
ID574550
Institutional Source Beutler Lab
Gene Symbol Olfr1490
Ensembl Gene ENSMUSG00000061387
Gene Nameolfactory receptor 1490
SynonymsMOR266-6P, GA_x6K02T2RE5P-3987000-3987950
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R7405 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location13651091-13659545 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13654882 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 151 (V151A)
Ref Sequence ENSEMBL: ENSMUSP00000151186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080162] [ENSMUST00000213900]
Predicted Effect probably benign
Transcript: ENSMUST00000080162
AA Change: V146A

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000079057
Gene: ENSMUSG00000061387
AA Change: V146A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.3e-48 PFAM
Pfam:7tm_1 41 290 2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213900
AA Change: V151A

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G T 17: 9,001,817 V383L probably damaging Het
1700012P22Rik T C 4: 144,419,753 N110S probably damaging Het
2410141K09Rik T C 13: 66,431,059 Q455R unknown Het
4930507D05Rik C A 10: 62,449,784 H96N unknown Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
5730480H06Rik T C 5: 48,388,116 I235T possibly damaging Het
Abcb11 A G 2: 69,287,619 Y472H probably damaging Het
Adam39 A T 8: 40,824,622 I17L probably benign Het
Aire T C 10: 78,034,613 H458R probably benign Het
Ap3d1 T C 10: 80,741,900 D31G probably benign Het
Atad2b T A 12: 4,943,232 H250Q probably benign Het
Borcs5 C A 6: 134,685,982 T74N probably benign Het
Btbd16 C T 7: 130,805,856 T292I probably benign Het
Catsperd G A 17: 56,632,335 V55M possibly damaging Het
Ctr9 T C 7: 111,043,714 F462S possibly damaging Het
Cyp4f39 A G 17: 32,481,815 S153G probably benign Het
Ddo T C 10: 40,647,997 C328R possibly damaging Het
Ddr1 A G 17: 35,690,100 V251A probably damaging Het
Dis3l A G 9: 64,314,704 F475L probably damaging Het
Dkk4 G A 8: 22,625,843 V99M probably benign Het
Dync1h1 C T 12: 110,634,220 A1938V probably damaging Het
Ecel1 A T 1: 87,153,516 probably null Het
Fbxo7 T A 10: 86,044,581 Y377N probably damaging Het
Fbxw24 T C 9: 109,607,068 I299V possibly damaging Het
Fkbp10 C T 11: 100,415,881 A33V probably damaging Het
Gabra1 T C 11: 42,155,023 T87A probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm884 A T 11: 103,615,161 Y1994N probably benign Het
Golga3 A T 5: 110,208,446 I1000F probably damaging Het
Grid2ip T C 5: 143,380,444 I563T probably benign Het
Gsx1 T C 5: 147,189,133 S82P possibly damaging Het
Heg1 A G 16: 33,763,449 K34E possibly damaging Het
Kank1 T A 19: 25,410,319 L452* probably null Het
Lce1k A T 3: 92,806,874 M1K probably null Het
Lcmt2 A G 2: 121,139,387 I185T probably benign Het
Lrp1 T C 10: 127,581,751 D1046G possibly damaging Het
Mast3 A T 8: 70,786,171 D496E probably damaging Het
Mst1r C T 9: 107,915,122 S925F possibly damaging Het
Mterf2 C T 10: 85,120,496 G88D probably damaging Het
Mthfd1 T C 12: 76,311,874 V783A probably damaging Het
Mybpc2 A T 7: 44,507,194 W778R probably damaging Het
Nbea A G 3: 55,805,266 L2130P possibly damaging Het
Ndst4 A G 3: 125,683,216 N30S probably benign Het
Nphs1 T C 7: 30,462,828 V299A possibly damaging Het
Nup107 T C 10: 117,770,415 D474G probably benign Het
Olfr1118 A C 2: 87,308,995 I89L probably benign Het
Olfr225 T A 11: 59,614,073 F370I possibly damaging Het
Olfr8 T C 10: 78,955,697 V164A probably benign Het
Pgap2 T C 7: 102,231,388 V41A probably benign Het
Plekhh1 C T 12: 79,055,047 T297I probably benign Het
Plxna4 A T 6: 32,196,319 Y1226N probably benign Het
Polr3b A G 10: 84,684,179 D653G probably benign Het
Ppp2r2c T C 5: 36,947,142 F289L possibly damaging Het
Prickle2 A G 6: 92,458,543 S82P probably damaging Het
Ptger2 T A 14: 44,989,074 V37D probably damaging Het
Rasa2 G A 9: 96,566,027 P526S probably benign Het
Rbm47 A T 5: 66,026,495 I255N probably damaging Het
Sez6 A T 11: 77,962,891 T296S probably benign Het
Slc2a9 T A 5: 38,391,824 I316F probably damaging Het
Slc41a1 T A 1: 131,839,146 V134D probably damaging Het
Slc5a7 A T 17: 54,297,133 S2T probably benign Het
Slc9a4 C T 1: 40,600,926 R293C probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Suco A G 1: 161,828,214 F1039L possibly damaging Het
Sycp1 A G 3: 102,925,227 Y208H possibly damaging Het
Tpr T C 1: 150,442,127 S2129P probably benign Het
Trim34b T A 7: 104,336,483 S442T probably damaging Het
Ttn A T 2: 76,743,346 Y25734* probably null Het
Uchl5 C T 1: 143,800,014 Q276* probably null Het
Wrn C G 8: 33,248,966 W1278S probably benign Het
Yeats2 T A 16: 20,222,913 D1184E probably damaging Het
Zfat G A 15: 68,184,485 R241W probably damaging Het
Zfp646 T A 7: 127,878,796 Y48* probably null Het
Other mutations in Olfr1490
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Olfr1490 APN 19 13654933 missense probably damaging 0.96
IGL01335:Olfr1490 APN 19 13655176 missense probably damaging 1.00
IGL01561:Olfr1490 APN 19 13654905 missense probably benign
IGL01644:Olfr1490 APN 19 13655404 utr 3 prime probably benign
IGL02257:Olfr1490 APN 19 13655265 missense probably benign
IGL02282:Olfr1490 APN 19 13655258 missense probably damaging 1.00
IGL02355:Olfr1490 APN 19 13655233 missense probably benign 0.02
IGL02362:Olfr1490 APN 19 13655233 missense probably benign 0.02
IGL02639:Olfr1490 APN 19 13654596 missense possibly damaging 0.73
R0078:Olfr1490 UTSW 19 13654815 missense probably benign 0.00
R0278:Olfr1490 UTSW 19 13654764 missense probably damaging 1.00
R0278:Olfr1490 UTSW 19 13654765 missense probably damaging 1.00
R0506:Olfr1490 UTSW 19 13654897 missense possibly damaging 0.62
R0927:Olfr1490 UTSW 19 13654452 missense probably damaging 0.99
R1087:Olfr1490 UTSW 19 13655012 nonsense probably null
R1762:Olfr1490 UTSW 19 13654504 missense probably benign
R2901:Olfr1490 UTSW 19 13654945 missense probably damaging 1.00
R2907:Olfr1490 UTSW 19 13655247 missense possibly damaging 0.84
R3625:Olfr1490 UTSW 19 13654982 nonsense probably null
R3838:Olfr1490 UTSW 19 13654957 missense probably benign 0.00
R4745:Olfr1490 UTSW 19 13655386 missense probably benign
R4804:Olfr1490 UTSW 19 13654518 missense probably benign
R5026:Olfr1490 UTSW 19 13654932 missense probably benign 0.03
R5314:Olfr1490 UTSW 19 13655266 missense probably benign 0.08
R6052:Olfr1490 UTSW 19 13654507 missense possibly damaging 0.95
R6235:Olfr1490 UTSW 19 13654781 nonsense probably null
R7557:Olfr1490 UTSW 19 13655026 missense possibly damaging 0.71
R8038:Olfr1490 UTSW 19 13655355 missense possibly damaging 0.91
Z1176:Olfr1490 UTSW 19 13654463 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACCATTTCTCTGCTGAGCTG -3'
(R):5'- AGTTTGAGCACAGCAGCCAC -3'

Sequencing Primer
(F):5'- TGAGCTGTGCCACTCAGATG -3'
(R):5'- CCACTATCAAGGCATAGGTGGTG -3'
Posted On2019-09-13