Mutagenetix > Incidental Mutation

Incidental Mutation 'R7144:Kiz'

574553

Institutional Source

Beutler Lab

Gene Symbol

Kiz

Ensembl Gene

ENSMUSG00000074749

Gene Name

kizuna centrosomal protein

Synonyms

Plk1s1, LOC228730, Ncrna00153, Gm114

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7144 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

146855864-146970097 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to G at 146950510 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000096884 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099278]

AlphaFold

Q3UXL4

Predicted Effect

probably null
Transcript: ENSMUST00000099278

SMART Domains

Protein: ENSMUSP00000096884
Gene: ENSMUSG00000074749

Domain	Start	End	E-Value	Type
low complexity region	3	11	N/A	INTRINSIC
low complexity region	15	26	N/A	INTRINSIC
low complexity region	60	75	N/A	INTRINSIC
coiled coil region	102	132	N/A	INTRINSIC
low complexity region	302	313	N/A	INTRINSIC
low complexity region	376	399	N/A	INTRINSIC
low complexity region	632	646	N/A	INTRINSIC
low complexity region	679	694	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

99% (95/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to centrosomes, strengthening and stabilizing the pericentriolar region prior to spindle formation. The encoded protein usually remains with the mother centrosome after centrosomal duplication. Sevral transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous mutants with truncated C-term transcript were normal size and weight, bred normally with normal litter size, and no obvious defects during fetal or adult development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	T	7: 120,433,573	I272F	possibly damaging	Het
Adcy10	G	T	1: 165,510,370	M184I	probably benign	Het
Aldoa	G	T	7: 126,796,862	T124N	possibly damaging	Het
Ap4e1	T	A	2: 127,011,807	I55N	probably damaging	Het
Arhgap21	T	C	2: 20,865,387	T913A	probably benign	Het
Atrnl1	G	A	19: 58,042,352	E1309K	probably damaging	Het
BC034090	A	T	1: 155,242,031	C114S	probably damaging	Het
Brinp2	A	G	1: 158,295,424		probably null	Het
Ccna1	G	T	3: 55,045,699	H408Q	probably benign	Het
Cd209g	T	G	8: 4,135,189		probably benign	Het
Cdc20b	A	G	13: 113,083,371	I433V	probably benign	Het
Cdk2ap1	G	A	5: 124,354,358	P5L	probably damaging	Het
Cep128	T	C	12: 91,294,159	E310G	probably damaging	Het
Cflar	G	T	1: 58,753,848	V458F		Het
Clec4b2	A	G	6: 123,181,384	T70A	probably benign	Het
Cntnap5c	A	G	17: 58,286,888	T741A	probably benign	Het
Csf3r	A	T	4: 126,043,722	T800S	probably benign	Het
Csnk1g2	T	C	10: 80,637,899	Y67H	probably damaging	Het
Cyp2c67	A	T	19: 39,615,694	V406E	probably benign	Het
Dnah10	A	G	5: 124,822,942	D3868G	probably damaging	Het
Dnah7a	A	T	1: 53,698,708		probably null	Het
Dst	A	G	1: 34,152,243	N208S	probably damaging	Het
Echdc3	A	G	2: 6,206,413		probably null	Het
Edrf1	T	C	7: 133,637,849	S13P	probably benign	Het
Ephb1	T	C	9: 101,964,077	Y734C	probably damaging	Het
Eps8l1	A	G	7: 4,472,185	Y325C	probably damaging	Het
Evc2	A	G	5: 37,386,839	D644G	probably damaging	Het
Eya4	A	C	10: 23,173,045	D54E	probably benign	Het
Filip1	T	C	9: 79,820,213	S375G	possibly damaging	Het
Fmo9	A	G	1: 166,677,620	M68T	probably benign	Het
Gemin5	G	C	11: 58,141,663	P772A	probably benign	Het
Gle1	T	G	2: 29,943,793	C401G	probably damaging	Het
Gm14548	A	G	7: 3,897,616	V45A	probably damaging	Het
Gm7298	A	T	6: 121,761,587	I376F	probably damaging	Het
Gpr35	A	C	1: 92,982,631	I22L	probably benign	Het
Grin2b	T	G	6: 135,733,476	D1024A	possibly damaging	Het
Hmcn1	T	C	1: 150,663,873	N2956D	probably damaging	Het
Htt	T	C	5: 34,846,006	L1275P	probably damaging	Het
Ibtk	T	C	9: 85,743,691	D2G	probably benign	Het
Il16	T	A	7: 83,646,451	D1170V	probably damaging	Het
Iqgap3	T	A	3: 88,116,910	I1513N	probably damaging	Het
Krt12	A	T	11: 99,416,013	*488K	probably null	Het
Lap3	A	T	5: 45,496,948	T83S	probably benign	Het
Lars2	T	A	9: 123,431,993	S410T	probably damaging	Het
Limch1	A	G	5: 67,017,658	T518A	probably benign	Het
Lrrc49	A	T	9: 60,615,156	S381T	probably damaging	Het
Lrrk2	A	G	15: 91,734,055	D919G	possibly damaging	Het
Mmp1a	A	T	9: 7,475,318	S363C	probably damaging	Het
Mrps22	A	C	9: 98,601,471		probably null	Het
Mybpc3	T	C	2: 91,134,604	I1066T	probably benign	Het
Myo10	A	T	15: 25,723,925	N215I	probably damaging	Het
Myocd	A	C	11: 65,218,648	L99R	probably damaging	Het
Nadk	T	G	4: 155,589,336	I394S	probably damaging	Het
Nadsyn1	T	C	7: 143,811,215	N251S	probably damaging	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Ncapd2	G	A	6: 125,176,670	P694L	probably benign	Het
Olfr1101	G	T	2: 86,988,820	R119S	probably damaging	Het
Olfr1243	T	C	2: 89,527,557	I284M	probably damaging	Het
Olfr317	A	C	11: 58,732,745	L140R	probably damaging	Het
Olfr705	T	A	7: 106,873,868	I126F	probably damaging	Het
Pcdhb13	T	A	18: 37,443,256	I229K	probably damaging	Het
Pgbd5	A	T	8: 124,374,317	M400K	possibly damaging	Het
Phactr3	A	G	2: 178,302,736	N409S	probably damaging	Het
Pik3c2g	C	A	6: 139,629,870	P305Q	probably damaging	Het
Pik3r4	G	A	9: 105,650,584	V379M	probably damaging	Het
Pkd1l2	A	T	8: 117,076,131	C250*	probably null	Het
Pramef17	A	C	4: 143,991,533	S447A	probably benign	Het
Rapgef6	A	C	11: 54,657,365	T792P	possibly damaging	Het
Rexo5	A	G	7: 119,805,191	D170G	probably damaging	Het
Rnf17	G	A	14: 56,512,332		probably null	Het
Sept11	A	G	5: 93,156,866	I181V	probably benign	Het
Serpina1e	T	G	12: 103,947,018	*414C	probably null	Het
Serpine1	C	A	5: 137,071,064	Q80H	probably damaging	Het
Sh3bp2	A	G	5: 34,561,631	N560S	probably benign	Het
Slc25a25	A	G	2: 32,419,166	F221S	probably damaging	Het
Spag17	G	T	3: 100,027,401		probably null	Het
Sspn	T	C	6: 145,961,155	L104P	probably damaging	Het
St18	A	C	1: 6,833,594	E693A	probably damaging	Het
St6galnac3	T	C	3: 153,411,532	I185V	possibly damaging	Het
St8sia1	T	C	6: 142,876,669	D156G	probably damaging	Het
Syne2	C	A	12: 76,005,378	S4092R	probably benign	Het
Tll1	T	A	8: 64,124,945	D76V	possibly damaging	Het
Tmco1	C	T	1: 167,308,453		probably benign	Het
Tnfaip3	T	A	10: 19,007,281	T179S	probably benign	Het
Trav16	T	C	14: 53,743,639	I95T	possibly damaging	Het
Trip12	A	T	1: 84,793,714	S280T	probably damaging	Het
Unc79	A	G	12: 103,142,626	M2166V	probably benign	Het
Vmn2r1	A	G	3: 64,089,941	I339M	probably damaging	Het
Vwa5b1	A	G	4: 138,605,431		probably null	Het
Washc4	A	T	10: 83,573,774		probably null	Het
Wisp1	T	A	15: 66,913,030	V184E	probably damaging	Het
Wiz	A	G	17: 32,357,628	S642P	possibly damaging	Het
Zeb2	T	A	2: 45,110,041	K60N	possibly damaging	Het
Zfat	T	A	15: 68,178,782	T797S	probably benign	Het
Zfp74	T	C	7: 29,935,165	K373E	probably damaging	Het
Zswim5	T	C	4: 116,975,976		probably null	Het

Other mutations in Kiz

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01448:Kiz	APN	2	146863801	missense	probably benign	0.22
IGL01649:Kiz	APN	2	146889309	missense	probably benign	0.35
IGL02184:Kiz	APN	2	146889600	missense	probably benign	0.20
IGL02500:Kiz	APN	2	146863813	missense	probably benign	0.06
IGL02548:Kiz	APN	2	146870770	missense	probably damaging	0.99
R0284:Kiz	UTSW	2	146863810	missense	probably benign	0.22
R0364:Kiz	UTSW	2	146942156	missense	probably benign	0.20
R0478:Kiz	UTSW	2	146942158	missense	possibly damaging	0.93
R0685:Kiz	UTSW	2	146856058	splice site	probably benign
R0767:Kiz	UTSW	2	146889051	missense	probably damaging	1.00
R0866:Kiz	UTSW	2	146856053	splice site	probably benign
R1180:Kiz	UTSW	2	146970007	missense	unknown
R2037:Kiz	UTSW	2	146969960	missense	probably damaging	1.00
R2055:Kiz	UTSW	2	146891283	missense	probably benign	0.10
R2877:Kiz	UTSW	2	146889556	missense	possibly damaging	0.75
R4780:Kiz	UTSW	2	146889246	missense	possibly damaging	0.90
R4822:Kiz	UTSW	2	146891069	missense	probably damaging	1.00
R4835:Kiz	UTSW	2	146942088	missense	probably damaging	1.00
R5004:Kiz	UTSW	2	146969979	missense	possibly damaging	0.83
R5473:Kiz	UTSW	2	146969995	nonsense	probably null
R5878:Kiz	UTSW	2	146889601	missense	probably damaging	0.99
R6216:Kiz	UTSW	2	146889497	missense	probably damaging	1.00
R6222:Kiz	UTSW	2	146891061	missense	probably damaging	1.00
R7475:Kiz	UTSW	2	146891086	missense	possibly damaging	0.90
R7580:Kiz	UTSW	2	146956249	missense	probably damaging	0.99
R7848:Kiz	UTSW	2	146889180	missense	probably benign	0.19
R8395:Kiz	UTSW	2	146953029	missense	possibly damaging	0.79
R8513:Kiz	UTSW	2	146870764	critical splice acceptor site	probably null
R8933:Kiz	UTSW	2	146942117	missense
R9146:Kiz	UTSW	2	146863820	missense	probably benign	0.39
R9352:Kiz	UTSW	2	146953007	missense	probably damaging	0.99
RF021:Kiz	UTSW	2	146870830	missense	possibly damaging	0.74
Z1177:Kiz	UTSW	2	146935827	missense	possibly damaging	0.59

Predicted Primers

PCR Primer
(F):5'- GCAGCAAGCAGTTGTGAGATC -3'
(R):5'- TCCTAATTCACAGGGGCTGC -3'

Sequencing Primer
(F):5'- GCAGTTGTGAGATCTAACGGC -3'
(R):5'- CCGGGGCAGTGTCAGAAAAG -3'

Posted On

2019-09-18