Incidental Mutation 'R7208:1110008L16Rik'
Institutional Source Beutler Lab
Gene Symbol 1110008L16Rik
Ensembl Gene ENSMUSG00000021023
Gene NameRIKEN cDNA 1110008L16 gene
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R7208 (G1)
Quality Score71.0074
Status Validated
Chromosomal Location55299577-55382533 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 55308645 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021411] [ENSMUST00000183475] [ENSMUST00000183654] [ENSMUST00000184766] [ENSMUST00000184980]
Predicted Effect probably null
Transcript: ENSMUST00000021411
SMART Domains Protein: ENSMUSP00000021411
Gene: ENSMUSG00000021023

Pfam:PRORP 339 575 4.8e-106 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000183475
SMART Domains Protein: ENSMUSP00000139252
Gene: ENSMUSG00000021023

low complexity region 410 424 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183654
SMART Domains Protein: ENSMUSP00000138821
Gene: ENSMUSG00000021023

Pfam:RNase_Zc3h12a 33 185 8e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000184766
SMART Domains Protein: ENSMUSP00000139204
Gene: ENSMUSG00000021023

PDB:4G26|A 153 581 1e-9 PDB
Predicted Effect probably null
Transcript: ENSMUST00000184980
SMART Domains Protein: ENSMUSP00000139123
Gene: ENSMUSG00000021023

low complexity region 113 127 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 99% (76/77)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,074,630 K854E probably damaging Het
Abcd2 G T 15: 91,190,682 Y309* probably null Het
Ache G A 5: 137,291,489 G360D probably damaging Het
Acot12 T C 13: 91,781,242 L396P probably benign Het
Acox2 T G 14: 8,241,303 D603A probably benign Het
Adam3 C A 8: 24,711,401 K245N probably damaging Het
Ankhd1 T C 18: 36,625,028 I925T probably benign Het
Arhgap27 C T 11: 103,360,759 V48M probably damaging Het
Atm A T 9: 53,512,008 probably null Het
B4galt4 T A 16: 38,753,940 F92Y probably damaging Het
Brwd1 C T 16: 96,035,959 R891Q probably damaging Het
Calcr T C 6: 3,687,612 Q462R probably benign Het
Ccdc112 T C 18: 46,287,631 R351G probably damaging Het
Ccdc80 T G 16: 45,096,710 S610A probably benign Het
Cdh20 C A 1: 104,954,071 N420K possibly damaging Het
Cntn3 G A 6: 102,278,422 R172* probably null Het
Ctnnd1 G T 2: 84,622,046 Q78K possibly damaging Het
D16Ertd472e A T 16: 78,575,926 L41H probably damaging Het
Dclk2 A T 3: 86,799,602 probably null Het
Dmwd C T 7: 19,080,309 H295Y probably benign Het
Dnaic2 T C 11: 114,757,162 V588A unknown Het
Dtx4 C T 19: 12,482,073 probably null Het
Dync2h1 C A 9: 7,141,059 D1323Y probably damaging Het
Fcgbp T A 7: 28,104,021 H1683Q probably benign Het
Fndc3c1 G C X: 106,435,073 L724V possibly damaging Het
Gm4070 A C 7: 105,902,179 S555R possibly damaging Het
Gm9195 A G 14: 72,451,752 S1876P possibly damaging Het
Grhl2 A C 15: 37,335,736 K431T probably damaging Het
Grm7 T G 6: 111,358,569 I647S possibly damaging Het
Gtf2ird1 T C 5: 134,411,094 N94S probably benign Het
Hmgcs1 G T 13: 119,701,084 G195W probably damaging Het
Hrc A T 7: 45,336,565 Y380F possibly damaging Het
Kcnu1 C T 8: 25,919,637 Q863* probably null Het
Lemd2 G A 17: 27,196,191 P300L probably damaging Het
Lnpep A T 17: 17,552,910 Y665* probably null Het
Lrfn1 A G 7: 28,467,139 T653A probably benign Het
Ly6g6c A G 17: 35,067,411 T8A unknown Het
Mcm5 T C 8: 75,121,716 probably null Het
Med28 A T 5: 45,523,452 D86V probably damaging Het
Mup11 A G 4: 60,659,726 S171P possibly damaging Het
Nckap1 A G 2: 80,540,198 F383L probably benign Het
Nid1 G C 13: 13,468,385 G303R probably benign Het
Nkain3 A G 4: 20,282,892 V147A probably benign Het
Olfr361 A G 2: 37,085,658 V30A probably benign Het
Pde9a G A 17: 31,420,284 V63I possibly damaging Het
Pdlim2 T A 14: 70,174,377 I69F probably damaging Het
Phf20l1 T C 15: 66,604,789 I245T probably benign Het
Prmt8 C T 6: 127,689,829 R394H possibly damaging Het
Prpf4b T A 13: 34,884,011 D274E unknown Het
Psmd6 A T 14: 14,112,225 probably null Het
Rgs16 T C 1: 153,741,670 L69P probably damaging Het
Robo3 A T 9: 37,424,724 I482N probably damaging Het
Scara3 C T 14: 65,931,266 V301I possibly damaging Het
Serpina1b T A 12: 103,728,294 H397L probably benign Het
Skint11 T A 4: 114,231,747 L246Q probably damaging Het
Skint5 T A 4: 113,539,339 R1212S unknown Het
Slc11a2 T C 15: 100,402,332 D348G probably benign Het
Slc15a2 T C 16: 36,756,281 K495E probably benign Het
Son T G 16: 91,662,102 D2072E unknown Het
Stau1 A G 2: 166,963,574 V34A probably damaging Het
Stk3 G T 15: 35,073,116 L153I possibly damaging Het
Swi5 A T 2: 32,287,910 V13E probably benign Het
Syne2 A T 12: 76,031,398 probably null Het
Synm T C 7: 67,734,915 M558V probably benign Het
Tep1 T A 14: 50,824,556 probably null Het
Tmc6 A G 11: 117,776,325 V149A probably benign Het
Tmem214 T A 5: 30,870,721 V95E possibly damaging Het
Tnnt2 T A 1: 135,850,376 probably null Het
Txlna A G 4: 129,631,278 probably null Het
Vmn2r26 T C 6: 124,061,989 I841T probably damaging Het
Wasf2 G A 4: 133,195,734 V452I probably damaging Het
Wdr62 C T 7: 30,252,336 D673N probably damaging Het
Wdr78 T G 4: 103,066,352 I427L probably benign Het
Wdr95 C T 5: 149,595,371 T559I probably benign Het
Zbtb40 A T 4: 136,999,626 probably null Het
Zfat T C 15: 68,180,007 E646G probably benign Het
Other mutations in 1110008L16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01701:1110008L16Rik APN 12 55308875 splice site probably benign
IGL01932:1110008L16Rik APN 12 55304125 missense probably benign
IGL03030:1110008L16Rik APN 12 55304644 missense probably damaging 1.00
R0102:1110008L16Rik UTSW 12 55382297 missense probably benign 0.37
R0892:1110008L16Rik UTSW 12 55382248 splice site probably null
R1479:1110008L16Rik UTSW 12 55379387 missense probably damaging 1.00
R1510:1110008L16Rik UTSW 12 55304212 missense probably benign 0.21
R1845:1110008L16Rik UTSW 12 55304332 missense possibly damaging 0.58
R1992:1110008L16Rik UTSW 12 55338206 missense probably damaging 1.00
R2307:1110008L16Rik UTSW 12 55304316 missense probably damaging 1.00
R4080:1110008L16Rik UTSW 12 55304613 missense possibly damaging 0.88
R4081:1110008L16Rik UTSW 12 55304613 missense possibly damaging 0.88
R4082:1110008L16Rik UTSW 12 55304613 missense possibly damaging 0.88
R5205:1110008L16Rik UTSW 12 55304441 nonsense probably null
R5590:1110008L16Rik UTSW 12 55304472 missense possibly damaging 0.89
R5940:1110008L16Rik UTSW 12 55304874 missense probably damaging 1.00
R5988:1110008L16Rik UTSW 12 55377217 missense probably damaging 1.00
R6147:1110008L16Rik UTSW 12 55379308 missense probably damaging 0.99
R7220:1110008L16Rik UTSW 12 55304415 missense possibly damaging 0.79
R7304:1110008L16Rik UTSW 12 55304644 missense probably damaging 1.00
R7316:1110008L16Rik UTSW 12 55304644 missense probably damaging 1.00
R7502:1110008L16Rik UTSW 12 55304421 missense probably damaging 1.00
R7908:1110008L16Rik UTSW 12 55379465 missense possibly damaging 0.56
R7967:1110008L16Rik UTSW 12 55304194 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gagtgtaaagcatgcatatata -3'
Posted On2019-09-18