Incidental Mutation 'R7230:Dlec1'
ID574589
Institutional Source Beutler Lab
Gene Symbol Dlec1
Ensembl Gene ENSMUSG00000038060
Gene Namedeleted in lung and esophageal cancer 1
SynonymsD630005C06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7230 (G1)
Quality Score51.0072
Status Validated
Chromosome9
Chromosomal Location119102478-119148246 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to G at 119124538 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055775] [ENSMUST00000140326] [ENSMUST00000165231]
Predicted Effect probably benign
Transcript: ENSMUST00000055775
SMART Domains Protein: ENSMUSP00000052645
Gene: ENSMUSG00000038060

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000140326
SMART Domains Protein: ENSMUSP00000122380
Gene: ENSMUSG00000038060

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165231
SMART Domains Protein: ENSMUSP00000128874
Gene: ENSMUSG00000038060

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1333 1354 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytogenetic location of this gene is 3p21.3, and it is located in a region that is commonly deleted in a variety of malignancies. Down-regulation of this gene has been observed in several human cancers including lung, esophageal, renal tumors, and head and neck squamous cell carcinoma. In some cases, reduced expression of this gene in tumor cells is a result of aberrant promoter methylation. Several alternatively spliced transcripts have been observed that contain disrupted coding regions and likely encode nonfunctional proteins.[provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A C 7: 46,117,388 D989E probably benign Het
Adad1 A G 3: 37,065,166 Y132C probably damaging Het
Adam33 A T 2: 131,053,563 C579S probably damaging Het
Adam6a A C 12: 113,545,582 Q525P probably damaging Het
Alpk3 C T 7: 81,093,294 P953L probably damaging Het
Atat1 A G 17: 35,909,439 S54P probably damaging Het
Bpgm A G 6: 34,487,567 E73G possibly damaging Het
Cab39 T A 1: 85,848,159 probably null Het
Ccdc162 A G 10: 41,678,813 L285P probably damaging Het
Ccdc30 T C 4: 119,339,782 E429G possibly damaging Het
Cct3 C T 3: 88,313,260 R260W probably damaging Het
Chd1 C A 17: 15,706,937 probably null Het
Cxcr4 T G 1: 128,589,790 T45P probably damaging Het
Disp2 G T 2: 118,791,805 R1006L probably damaging Het
Dram2 T G 3: 106,572,978 Y202* probably null Het
Etl4 C A 2: 20,797,988 T1035K probably damaging Het
F5 T C 1: 164,184,953 F479L probably benign Het
Fam172a G A 13: 77,759,472 E5K probably damaging Het
Frrs1l C A 4: 56,972,372 G110W probably damaging Het
Gpbp1l1 T A 4: 116,588,610 I303N probably damaging Het
Grik5 A G 7: 25,023,070 F538S probably damaging Het
Hgsnat C A 8: 25,954,832 probably null Het
Hs2st1 T C 3: 144,434,546 D338G probably benign Het
Impdh1 T C 6: 29,206,063 probably null Het
Ipo9 T C 1: 135,406,758 probably benign Het
Kdm4b T G 17: 56,369,155 L220R probably damaging Het
Map1a T A 2: 121,300,818 F705Y probably damaging Het
Med22 C T 2: 26,908,211 D99N probably benign Het
Muc6 T C 7: 141,649,214 Y519C probably damaging Het
Myt1l A G 12: 29,783,874 I25M probably damaging Het
Ncam1 T A 9: 49,509,823 I731F probably benign Het
Nlrp4f T A 13: 65,194,901 H310L probably benign Het
Olfr1286 A T 2: 111,420,916 F12I probably damaging Het
Olfr1306 T A 2: 111,912,561 Y123F probably damaging Het
Olfr694 A T 7: 106,689,524 M69K possibly damaging Het
Olfr701 C A 7: 106,818,179 T32K possibly damaging Het
Prl8a6 T A 13: 27,433,038 Y223F probably benign Het
Prss39 A G 1: 34,502,147 D244G probably damaging Het
Ptx4 A T 17: 25,123,103 Q184L possibly damaging Het
Slc26a1 A T 5: 108,671,745 D545E probably damaging Het
Slc7a12 T C 3: 14,505,381 S398P probably damaging Het
Slc9a4 T C 1: 40,600,771 V241A probably damaging Het
Snw1 T C 12: 87,464,554 D109G probably damaging Het
Syne2 T A 12: 75,933,900 I1477K probably benign Het
Timd4 A T 11: 46,810,864 Y18F probably benign Het
Tmprss2 A G 16: 97,578,597 Y168H probably benign Het
Ttn A T 2: 76,738,700 I27283K probably damaging Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Vasn C T 16: 4,649,622 R478C probably benign Het
Zfp58 A T 13: 67,491,963 C136* probably null Het
Other mutations in Dlec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Dlec1 APN 9 119102785 missense probably benign 0.11
IGL01137:Dlec1 APN 9 119137311 missense probably damaging 1.00
IGL01338:Dlec1 APN 9 119120911 missense probably damaging 1.00
IGL01652:Dlec1 APN 9 119143907 missense probably benign 0.01
IGL01923:Dlec1 APN 9 119128114 splice site probably null
IGL02186:Dlec1 APN 9 119143627 missense probably benign 0.00
IGL02597:Dlec1 APN 9 119134536 missense probably damaging 0.99
IGL02667:Dlec1 APN 9 119127466 missense probably benign 0.23
IGL02718:Dlec1 APN 9 119137286 missense probably benign 0.01
IGL02731:Dlec1 APN 9 119147120 missense probably benign 0.00
IGL02831:Dlec1 APN 9 119143915 missense probably damaging 1.00
IGL03390:Dlec1 APN 9 119123220 missense probably benign 0.00
I2288:Dlec1 UTSW 9 119143601 missense probably damaging 1.00
R0109:Dlec1 UTSW 9 119105824 missense probably damaging 1.00
R0144:Dlec1 UTSW 9 119142866 missense probably benign
R0554:Dlec1 UTSW 9 119115002 missense probably benign 0.44
R0611:Dlec1 UTSW 9 119112099 missense probably benign 0.01
R1344:Dlec1 UTSW 9 119130017 missense probably benign 0.09
R1467:Dlec1 UTSW 9 119142578 missense probably damaging 1.00
R1467:Dlec1 UTSW 9 119128003 splice site probably benign
R1467:Dlec1 UTSW 9 119142578 missense probably damaging 1.00
R1539:Dlec1 UTSW 9 119127450 missense probably benign 0.00
R1768:Dlec1 UTSW 9 119146007 splice site probably null
R1809:Dlec1 UTSW 9 119136699 missense probably benign 0.00
R1830:Dlec1 UTSW 9 119138790 missense probably benign 0.00
R1901:Dlec1 UTSW 9 119102644 missense probably damaging 0.99
R2060:Dlec1 UTSW 9 119112086 missense probably damaging 1.00
R2092:Dlec1 UTSW 9 119121844 missense possibly damaging 0.87
R2237:Dlec1 UTSW 9 119138191 critical splice donor site probably null
R2983:Dlec1 UTSW 9 119146173 missense probably benign 0.00
R3117:Dlec1 UTSW 9 119143903 unclassified probably null
R3816:Dlec1 UTSW 9 119124843 missense probably damaging 1.00
R3826:Dlec1 UTSW 9 119143061 splice site probably benign
R3965:Dlec1 UTSW 9 119128581 missense probably benign 0.01
R4023:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4024:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4026:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4272:Dlec1 UTSW 9 119143163 missense probably damaging 0.98
R4545:Dlec1 UTSW 9 119128078 missense probably damaging 0.99
R4546:Dlec1 UTSW 9 119128078 missense probably damaging 0.99
R4601:Dlec1 UTSW 9 119147134 critical splice donor site probably null
R4695:Dlec1 UTSW 9 119143153 missense probably benign 0.00
R4996:Dlec1 UTSW 9 119146050 missense probably damaging 1.00
R5321:Dlec1 UTSW 9 119112601 missense probably benign 0.02
R5521:Dlec1 UTSW 9 119143401 missense possibly damaging 0.92
R5650:Dlec1 UTSW 9 119143594 nonsense probably null
R5825:Dlec1 UTSW 9 119142968 missense probably damaging 1.00
R5941:Dlec1 UTSW 9 119126312 missense probably damaging 0.98
R6056:Dlec1 UTSW 9 119121923 missense probably damaging 0.98
R6111:Dlec1 UTSW 9 119102624 missense possibly damaging 0.59
R6156:Dlec1 UTSW 9 119110213 critical splice donor site probably null
R6160:Dlec1 UTSW 9 119143319 missense probably benign 0.02
R6195:Dlec1 UTSW 9 119137253 missense probably benign 0.00
R6364:Dlec1 UTSW 9 119121871 missense possibly damaging 0.84
R6480:Dlec1 UTSW 9 119147690 missense probably benign 0.34
R6808:Dlec1 UTSW 9 119126174 missense probably benign 0.01
R6813:Dlec1 UTSW 9 119112102 missense probably benign 0.02
R7019:Dlec1 UTSW 9 119112422 missense probably benign 0.01
R7048:Dlec1 UTSW 9 119143404 splice site probably null
R7187:Dlec1 UTSW 9 119112146 missense probably benign 0.14
R7585:Dlec1 UTSW 9 119142751 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGGTTACAGGTGAACTCTTTCATTC -3'
(R):5'- TGTGGCCCATCAAGTACCAC -3'

Sequencing Primer
(F):5'- TTCTCTTTGGAGTCCACTTTGAAC -3'
(R):5'- CCAAAGGCTGCCACAGG -3'
Posted On2019-09-18