Incidental Mutation 'R7254:Gm14412'
ID 574592
Institutional Source Beutler Lab
Gene Symbol Gm14412
Ensembl Gene ENSMUSG00000078868
Gene Name predicted gene 14412
Synonyms
MMRRC Submission 045315-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.724) question?
Stock # R7254 (G1)
Quality Score 67.0074
Status Validated
Chromosome 2
Chromosomal Location 177006313-177016100 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 177009189 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 22 (D22E)
Ref Sequence ENSEMBL: ENSMUSP00000104587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108959]
AlphaFold A2ARR7
Predicted Effect probably damaging
Transcript: ENSMUST00000108959
AA Change: D22E

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104587
Gene: ENSMUSG00000078868
AA Change: D22E

DomainStartEndE-ValueType
KRAB 4 66 1.54e-15 SMART
ZnF_C2H2 103 125 1.12e-3 SMART
ZnF_C2H2 131 153 2.15e-5 SMART
ZnF_C2H2 159 181 5.59e-4 SMART
ZnF_C2H2 187 209 1.98e-4 SMART
ZnF_C2H2 215 237 1.12e-3 SMART
ZnF_C2H2 243 265 6.52e-5 SMART
ZnF_C2H2 271 293 1.12e-3 SMART
ZnF_C2H2 299 321 5.59e-4 SMART
ZnF_C2H2 327 349 4.87e-4 SMART
ZnF_C2H2 355 377 2.61e-4 SMART
ZnF_C2H2 383 405 9.08e-4 SMART
ZnF_C2H2 411 433 4.87e-4 SMART
ZnF_C2H2 439 461 6.88e-4 SMART
ZnF_C2H2 467 489 4.61e-5 SMART
ZnF_C2H2 495 517 8.02e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A T 7: 43,147,623 (GRCm39) D249E probably damaging Het
Acacb A C 5: 114,347,812 (GRCm39) probably null Het
Adnp A G 2: 168,025,918 (GRCm39) V459A probably damaging Het
Arid3b T C 9: 57,704,037 (GRCm39) K304E probably damaging Het
Ash1l G T 3: 88,977,816 (GRCm39) R2713L probably damaging Het
Bmpr1a A C 14: 34,136,720 (GRCm39) D490E probably benign Het
Cacna1g A T 11: 94,323,393 (GRCm39) C1270* probably null Het
Cep295nl G T 11: 118,223,866 (GRCm39) P326Q probably damaging Het
Cfap100 T C 6: 90,383,043 (GRCm39) I377V unknown Het
Creb1 C T 1: 64,615,436 (GRCm39) Q223* probably null Het
Ctsc G A 7: 87,958,767 (GRCm39) G349D probably damaging Het
Ddx41 G A 13: 55,681,769 (GRCm39) R311* probably null Het
Dpcd A G 19: 45,565,473 (GRCm39) Q149R probably benign Het
Dse T A 10: 34,060,144 (GRCm39) probably benign Het
Dync2i1 A G 12: 116,226,205 (GRCm39) probably benign Het
Eef2k C T 7: 120,488,488 (GRCm39) H458Y probably benign Het
Gipr A T 7: 18,897,538 (GRCm39) V90E probably damaging Het
Gm21886 A T 18: 80,132,950 (GRCm39) C69* probably null Het
Gm5114 G A 7: 39,058,390 (GRCm39) L410F probably benign Het
Gmip T A 8: 70,269,118 (GRCm39) probably null Het
Gtf2f1 T C 17: 57,314,101 (GRCm39) T128A possibly damaging Het
Hnrnpr A G 4: 136,059,886 (GRCm39) E330G possibly damaging Het
Hoxd9 T A 2: 74,528,718 (GRCm39) W107R probably damaging Het
Iars1 T C 13: 49,876,554 (GRCm39) probably null Het
Idh2 TCCCAGGGCC TCC 7: 79,748,079 (GRCm39) probably null Het
Ifi213 G T 1: 173,421,529 (GRCm39) P120Q probably damaging Het
Il6 A T 5: 30,219,906 (GRCm39) Q94L probably benign Het
Kcnab1 A G 3: 65,226,908 (GRCm39) S196G probably benign Het
Kcnv1 C T 15: 44,976,604 (GRCm39) V228I probably benign Het
Lars2 A G 9: 123,284,028 (GRCm39) T739A possibly damaging Het
Med13 T C 11: 86,210,661 (GRCm39) S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,660,931 (GRCm39) probably null Het
Myh9 T G 15: 77,650,024 (GRCm39) Q1646P probably damaging Het
Nif3l1 T A 1: 58,489,625 (GRCm39) S171R probably benign Het
Or13n4 A G 7: 106,422,777 (GRCm39) *319Q probably null Het
Or1e1c A G 11: 73,266,201 (GRCm39) I212V probably benign Het
Or1r1 A G 11: 73,874,603 (GRCm39) V277A probably benign Het
Or51f23 A G 7: 102,452,765 (GRCm39) T27A probably benign Het
Or5b113 A T 19: 13,342,475 (GRCm39) D161V probably benign Het
Or6c5b T C 10: 129,245,649 (GRCm39) V138A probably benign Het
Or8c8 T C 9: 38,164,719 (GRCm39) M2T probably benign Het
Pak5 A T 2: 135,958,684 (GRCm39) S135T possibly damaging Het
Prr29 A T 11: 106,265,684 (GRCm39) M1L probably damaging Het
Ptpn13 T A 5: 103,742,502 (GRCm39) V2407E probably damaging Het
Ralgapa1 T A 12: 55,741,978 (GRCm39) H1310L probably damaging Het
Raph1 T C 1: 60,538,767 (GRCm39) S393G unknown Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Ror2 A G 13: 53,272,756 (GRCm39) I303T possibly damaging Het
Runx2 G A 17: 45,125,079 (GRCm39) P80L probably damaging Het
Scn10a C T 9: 119,447,921 (GRCm39) D1378N probably damaging Het
Serpinc1 T A 1: 160,821,188 (GRCm39) C91S probably benign Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Spata31d1e T C 13: 59,889,790 (GRCm39) I677V probably benign Het
Tada1 T A 1: 166,216,217 (GRCm39) C139* probably null Het
Tbr1 T A 2: 61,636,386 (GRCm39) V254E probably damaging Het
Timd4 A T 11: 46,734,016 (GRCm39) I340F probably benign Het
Tubb2a T C 13: 34,258,515 (GRCm39) Y425C probably damaging Het
Zfp292 A T 4: 34,819,476 (GRCm39) M287K probably damaging Het
Other mutations in Gm14412
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Gm14412 APN 2 177,007,479 (GRCm39) missense probably benign
R0124:Gm14412 UTSW 2 177,007,705 (GRCm39) splice site probably benign
R0507:Gm14412 UTSW 2 177,006,325 (GRCm39) missense possibly damaging 0.46
R1833:Gm14412 UTSW 2 177,007,583 (GRCm39) missense probably benign 0.00
R1908:Gm14412 UTSW 2 177,007,630 (GRCm39) missense probably benign 0.03
R1908:Gm14412 UTSW 2 177,007,269 (GRCm39) missense probably damaging 1.00
R2026:Gm14412 UTSW 2 177,008,898 (GRCm39) missense possibly damaging 0.92
R2209:Gm14412 UTSW 2 177,009,229 (GRCm39) missense probably damaging 1.00
R2656:Gm14412 UTSW 2 177,006,993 (GRCm39) missense unknown
R3946:Gm14412 UTSW 2 177,006,478 (GRCm39) nonsense probably null
R4430:Gm14412 UTSW 2 177,007,625 (GRCm39) missense probably benign 0.09
R4537:Gm14412 UTSW 2 177,006,352 (GRCm39) missense probably benign 0.06
R4595:Gm14412 UTSW 2 177,007,005 (GRCm39) missense unknown
R4928:Gm14412 UTSW 2 177,006,373 (GRCm39) missense probably benign 0.01
R5100:Gm14412 UTSW 2 177,006,908 (GRCm39) missense probably damaging 0.99
R5434:Gm14412 UTSW 2 177,006,405 (GRCm39) missense probably damaging 1.00
R5668:Gm14412 UTSW 2 177,007,402 (GRCm39) nonsense probably null
R6173:Gm14412 UTSW 2 177,006,330 (GRCm39) missense probably damaging 1.00
R6558:Gm14412 UTSW 2 177,006,347 (GRCm39) missense probably damaging 0.99
R6784:Gm14412 UTSW 2 177,009,133 (GRCm39) missense probably benign 0.10
R7094:Gm14412 UTSW 2 177,009,138 (GRCm39) missense probably damaging 1.00
R7182:Gm14412 UTSW 2 177,007,408 (GRCm39) missense probably benign 0.44
R7793:Gm14412 UTSW 2 177,007,660 (GRCm39) missense possibly damaging 0.78
R7799:Gm14412 UTSW 2 177,007,590 (GRCm39) missense probably benign 0.01
R8238:Gm14412 UTSW 2 177,007,111 (GRCm39) missense unknown
R9098:Gm14412 UTSW 2 177,006,356 (GRCm39) missense probably damaging 1.00
R9304:Gm14412 UTSW 2 177,007,547 (GRCm39) missense probably benign
R9699:Gm14412 UTSW 2 177,007,636 (GRCm39) nonsense probably null
RF001:Gm14412 UTSW 2 177,008,894 (GRCm39) missense probably benign 0.04
RF007:Gm14412 UTSW 2 177,007,494 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GTTCTTCCCAAATGTAACCTAAACC -3'
(R):5'- AAAAGTACTATGTGGTTGGGCAGTG -3'

Sequencing Primer
(F):5'- CCCAGTACCAGAGAAAGTATGTTAC -3'
(R):5'- GCAGTCAGCGAATATTCATTTTG -3'
Posted On 2019-09-18