Incidental Mutation 'R7254:Gm14412'
ID 574592
Institutional Source Beutler Lab
Gene Symbol Gm14412
Ensembl Gene ENSMUSG00000078868
Gene Name predicted gene 14412
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.752) question?
Stock # R7254 (G1)
Quality Score 67.0074
Status Validated
Chromosome 2
Chromosomal Location 177314520-177324307 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 177317396 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 22 (D22E)
Ref Sequence ENSEMBL: ENSMUSP00000104587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108959]
AlphaFold A2ARR7
Predicted Effect probably damaging
Transcript: ENSMUST00000108959
AA Change: D22E

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104587
Gene: ENSMUSG00000078868
AA Change: D22E

DomainStartEndE-ValueType
KRAB 4 66 1.54e-15 SMART
ZnF_C2H2 103 125 1.12e-3 SMART
ZnF_C2H2 131 153 2.15e-5 SMART
ZnF_C2H2 159 181 5.59e-4 SMART
ZnF_C2H2 187 209 1.98e-4 SMART
ZnF_C2H2 215 237 1.12e-3 SMART
ZnF_C2H2 243 265 6.52e-5 SMART
ZnF_C2H2 271 293 1.12e-3 SMART
ZnF_C2H2 299 321 5.59e-4 SMART
ZnF_C2H2 327 349 4.87e-4 SMART
ZnF_C2H2 355 377 2.61e-4 SMART
ZnF_C2H2 383 405 9.08e-4 SMART
ZnF_C2H2 411 433 4.87e-4 SMART
ZnF_C2H2 439 461 6.88e-4 SMART
ZnF_C2H2 467 489 4.61e-5 SMART
ZnF_C2H2 495 517 8.02e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,741,976 I677V probably benign Het
4931406B18Rik A T 7: 43,498,199 D249E probably damaging Het
Acacb A C 5: 114,209,751 probably null Het
Adnp A G 2: 168,183,998 V459A probably damaging Het
Arid3b T C 9: 57,796,754 K304E probably damaging Het
Ash1l G T 3: 89,070,509 R2713L probably damaging Het
Bmpr1a A C 14: 34,414,763 D490E probably benign Het
Cacna1g A T 11: 94,432,567 C1270* probably null Het
Cep295nl G T 11: 118,333,040 P326Q probably damaging Het
Cfap100 T C 6: 90,406,061 I377V unknown Het
Creb1 C T 1: 64,576,277 Q223* probably null Het
Ctsc G A 7: 88,309,559 G349D probably damaging Het
Ddx41 G A 13: 55,533,956 R311* probably null Het
Dse T A 10: 34,184,148 probably benign Het
Eef2k C T 7: 120,889,265 H458Y probably benign Het
Gipr A T 7: 19,163,613 V90E probably damaging Het
Gm17018 A G 19: 45,577,034 Q149R probably benign Het
Gm21886 A T 18: 80,089,735 C69* probably null Het
Gm5114 G A 7: 39,408,966 L410F probably benign Het
Gmip T A 8: 69,816,468 probably null Het
Gtf2f1 T C 17: 57,007,101 T128A possibly damaging Het
Hnrnpr A G 4: 136,332,575 E330G possibly damaging Het
Hoxd9 T A 2: 74,698,374 W107R probably damaging Het
Iars T C 13: 49,723,078 probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Ifi213 G T 1: 173,593,963 P120Q probably damaging Het
Il6 A T 5: 30,014,908 Q94L probably benign Het
Kcnab1 A G 3: 65,319,487 S196G probably benign Het
Kcnv1 C T 15: 45,113,208 V228I probably benign Het
Lars2 A G 9: 123,454,963 T739A possibly damaging Het
Med13 T C 11: 86,319,835 S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh9 T G 15: 77,765,824 Q1646P probably damaging Het
Nif3l1 T A 1: 58,450,466 S171R probably benign Het
Olfr143 T C 9: 38,253,423 M2T probably benign Het
Olfr1467 A T 19: 13,365,111 D161V probably benign Het
Olfr376 A G 11: 73,375,375 I212V probably benign Het
Olfr398 A G 11: 73,983,777 V277A probably benign Het
Olfr564 A G 7: 102,803,558 T27A probably benign Het
Olfr702 A G 7: 106,823,570 *319Q probably null Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Pak7 A T 2: 136,116,764 S135T possibly damaging Het
Prr29 A T 11: 106,374,858 M1L probably damaging Het
Ptpn13 T A 5: 103,594,636 V2407E probably damaging Het
Ralgapa1 T A 12: 55,695,193 H1310L probably damaging Het
Raph1 T C 1: 60,499,608 S393G unknown Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ror2 A G 13: 53,118,720 I303T possibly damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn10a C T 9: 119,618,855 D1378N probably damaging Het
Serpinc1 T A 1: 160,993,618 C91S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tada1 T A 1: 166,388,648 C139* probably null Het
Tbr1 T A 2: 61,806,042 V254E probably damaging Het
Timd4 A T 11: 46,843,189 I340F probably benign Het
Tubb2a T C 13: 34,074,532 Y425C probably damaging Het
Wdr60 A G 12: 116,262,585 probably benign Het
Zfp292 A T 4: 34,819,476 M287K probably damaging Het
Other mutations in Gm14412
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Gm14412 APN 2 177315686 missense probably benign
R0124:Gm14412 UTSW 2 177315912 splice site probably benign
R0507:Gm14412 UTSW 2 177314532 missense possibly damaging 0.46
R1833:Gm14412 UTSW 2 177315790 missense probably benign 0.00
R1908:Gm14412 UTSW 2 177315476 missense probably damaging 1.00
R1908:Gm14412 UTSW 2 177315837 missense probably benign 0.03
R2026:Gm14412 UTSW 2 177317105 missense possibly damaging 0.92
R2209:Gm14412 UTSW 2 177317436 missense probably damaging 1.00
R2656:Gm14412 UTSW 2 177315200 missense unknown
R3946:Gm14412 UTSW 2 177314685 nonsense probably null
R4430:Gm14412 UTSW 2 177315832 missense probably benign 0.09
R4537:Gm14412 UTSW 2 177314559 missense probably benign 0.06
R4595:Gm14412 UTSW 2 177315212 missense unknown
R4928:Gm14412 UTSW 2 177314580 missense probably benign 0.01
R5100:Gm14412 UTSW 2 177315115 missense probably damaging 0.99
R5434:Gm14412 UTSW 2 177314612 missense probably damaging 1.00
R5668:Gm14412 UTSW 2 177315609 nonsense probably null
R6173:Gm14412 UTSW 2 177314537 missense probably damaging 1.00
R6558:Gm14412 UTSW 2 177314554 missense probably damaging 0.99
R6784:Gm14412 UTSW 2 177317340 missense probably benign 0.10
R7094:Gm14412 UTSW 2 177317345 missense probably damaging 1.00
R7182:Gm14412 UTSW 2 177315615 missense probably benign 0.44
R7793:Gm14412 UTSW 2 177315867 missense possibly damaging 0.78
R7799:Gm14412 UTSW 2 177315797 missense probably benign 0.01
R8238:Gm14412 UTSW 2 177315318 missense unknown
R9098:Gm14412 UTSW 2 177314563 missense probably damaging 1.00
R9304:Gm14412 UTSW 2 177315754 missense probably benign
RF001:Gm14412 UTSW 2 177317101 missense probably benign 0.04
RF007:Gm14412 UTSW 2 177315701 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GTTCTTCCCAAATGTAACCTAAACC -3'
(R):5'- AAAAGTACTATGTGGTTGGGCAGTG -3'

Sequencing Primer
(F):5'- CCCAGTACCAGAGAAAGTATGTTAC -3'
(R):5'- GCAGTCAGCGAATATTCATTTTG -3'
Posted On 2019-09-18