Incidental Mutation 'R7254:Dync2i1'
ID 574595
Institutional Source Beutler Lab
Gene Symbol Dync2i1
Ensembl Gene ENSMUSG00000042050
Gene Name dynein 2 intermediate chain 1
Synonyms Dync2l1, D430033N04Rik, Wdr60
MMRRC Submission 045315-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7254 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 116169882-116226642 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to G at 116226205 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039349] [ENSMUST00000222679]
AlphaFold Q8C761
Predicted Effect probably benign
Transcript: ENSMUST00000039349
SMART Domains Protein: ENSMUSP00000047334
Gene: ENSMUSG00000042050

DomainStartEndE-ValueType
coiled coil region 84 122 N/A INTRINSIC
low complexity region 168 193 N/A INTRINSIC
low complexity region 226 242 N/A INTRINSIC
coiled coil region 280 309 N/A INTRINSIC
low complexity region 319 337 N/A INTRINSIC
low complexity region 439 453 N/A INTRINSIC
WD40 629 668 2.77e-1 SMART
Blast:WD40 694 755 2e-7 BLAST
WD40 846 881 3.84e0 SMART
WD40 884 926 5.55e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000222679
AA Change: V40A
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) and may facilitate the formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein contains four WD repeats and may play a role in the formation of cilia. Mutations in this gene have been associated with short-rib polydactyly and Jeune syndromes. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A T 7: 43,147,623 (GRCm39) D249E probably damaging Het
Acacb A C 5: 114,347,812 (GRCm39) probably null Het
Adnp A G 2: 168,025,918 (GRCm39) V459A probably damaging Het
Arid3b T C 9: 57,704,037 (GRCm39) K304E probably damaging Het
Ash1l G T 3: 88,977,816 (GRCm39) R2713L probably damaging Het
Bmpr1a A C 14: 34,136,720 (GRCm39) D490E probably benign Het
Cacna1g A T 11: 94,323,393 (GRCm39) C1270* probably null Het
Cep295nl G T 11: 118,223,866 (GRCm39) P326Q probably damaging Het
Cfap100 T C 6: 90,383,043 (GRCm39) I377V unknown Het
Creb1 C T 1: 64,615,436 (GRCm39) Q223* probably null Het
Ctsc G A 7: 87,958,767 (GRCm39) G349D probably damaging Het
Ddx41 G A 13: 55,681,769 (GRCm39) R311* probably null Het
Dpcd A G 19: 45,565,473 (GRCm39) Q149R probably benign Het
Dse T A 10: 34,060,144 (GRCm39) probably benign Het
Eef2k C T 7: 120,488,488 (GRCm39) H458Y probably benign Het
Gipr A T 7: 18,897,538 (GRCm39) V90E probably damaging Het
Gm14412 A T 2: 177,009,189 (GRCm39) D22E probably damaging Het
Gm21886 A T 18: 80,132,950 (GRCm39) C69* probably null Het
Gm5114 G A 7: 39,058,390 (GRCm39) L410F probably benign Het
Gmip T A 8: 70,269,118 (GRCm39) probably null Het
Gtf2f1 T C 17: 57,314,101 (GRCm39) T128A possibly damaging Het
Hnrnpr A G 4: 136,059,886 (GRCm39) E330G possibly damaging Het
Hoxd9 T A 2: 74,528,718 (GRCm39) W107R probably damaging Het
Iars1 T C 13: 49,876,554 (GRCm39) probably null Het
Idh2 TCCCAGGGCC TCC 7: 79,748,079 (GRCm39) probably null Het
Ifi213 G T 1: 173,421,529 (GRCm39) P120Q probably damaging Het
Il6 A T 5: 30,219,906 (GRCm39) Q94L probably benign Het
Kcnab1 A G 3: 65,226,908 (GRCm39) S196G probably benign Het
Kcnv1 C T 15: 44,976,604 (GRCm39) V228I probably benign Het
Lars2 A G 9: 123,284,028 (GRCm39) T739A possibly damaging Het
Med13 T C 11: 86,210,661 (GRCm39) S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,660,931 (GRCm39) probably null Het
Myh9 T G 15: 77,650,024 (GRCm39) Q1646P probably damaging Het
Nif3l1 T A 1: 58,489,625 (GRCm39) S171R probably benign Het
Or13n4 A G 7: 106,422,777 (GRCm39) *319Q probably null Het
Or1e1c A G 11: 73,266,201 (GRCm39) I212V probably benign Het
Or1r1 A G 11: 73,874,603 (GRCm39) V277A probably benign Het
Or51f23 A G 7: 102,452,765 (GRCm39) T27A probably benign Het
Or5b113 A T 19: 13,342,475 (GRCm39) D161V probably benign Het
Or6c5b T C 10: 129,245,649 (GRCm39) V138A probably benign Het
Or8c8 T C 9: 38,164,719 (GRCm39) M2T probably benign Het
Pak5 A T 2: 135,958,684 (GRCm39) S135T possibly damaging Het
Prr29 A T 11: 106,265,684 (GRCm39) M1L probably damaging Het
Ptpn13 T A 5: 103,742,502 (GRCm39) V2407E probably damaging Het
Ralgapa1 T A 12: 55,741,978 (GRCm39) H1310L probably damaging Het
Raph1 T C 1: 60,538,767 (GRCm39) S393G unknown Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Ror2 A G 13: 53,272,756 (GRCm39) I303T possibly damaging Het
Runx2 G A 17: 45,125,079 (GRCm39) P80L probably damaging Het
Scn10a C T 9: 119,447,921 (GRCm39) D1378N probably damaging Het
Serpinc1 T A 1: 160,821,188 (GRCm39) C91S probably benign Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Spata31d1e T C 13: 59,889,790 (GRCm39) I677V probably benign Het
Tada1 T A 1: 166,216,217 (GRCm39) C139* probably null Het
Tbr1 T A 2: 61,636,386 (GRCm39) V254E probably damaging Het
Timd4 A T 11: 46,734,016 (GRCm39) I340F probably benign Het
Tubb2a T C 13: 34,258,515 (GRCm39) Y425C probably damaging Het
Zfp292 A T 4: 34,819,476 (GRCm39) M287K probably damaging Het
Other mutations in Dync2i1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Dync2i1 APN 12 116,205,400 (GRCm39) missense probably benign 0.01
IGL00668:Dync2i1 APN 12 116,221,048 (GRCm39) missense probably benign 0.32
IGL00914:Dync2i1 APN 12 116,196,223 (GRCm39) missense probably damaging 1.00
IGL01061:Dync2i1 APN 12 116,193,324 (GRCm39) missense probably benign 0.45
IGL01375:Dync2i1 APN 12 116,193,296 (GRCm39) missense possibly damaging 0.91
IGL01758:Dync2i1 APN 12 116,182,418 (GRCm39) missense possibly damaging 0.82
IGL01930:Dync2i1 APN 12 116,189,583 (GRCm39) critical splice donor site probably null
IGL02028:Dync2i1 APN 12 116,219,681 (GRCm39) missense probably benign 0.06
IGL03180:Dync2i1 APN 12 116,182,485 (GRCm39) missense probably benign 0.07
F5770:Dync2i1 UTSW 12 116,175,460 (GRCm39) missense possibly damaging 0.73
R0153:Dync2i1 UTSW 12 116,196,256 (GRCm39) missense probably benign 0.01
R0265:Dync2i1 UTSW 12 116,221,026 (GRCm39) splice site probably benign
R0364:Dync2i1 UTSW 12 116,221,097 (GRCm39) splice site probably benign
R0601:Dync2i1 UTSW 12 116,219,555 (GRCm39) missense possibly damaging 0.79
R0624:Dync2i1 UTSW 12 116,211,910 (GRCm39) missense probably damaging 0.98
R0755:Dync2i1 UTSW 12 116,175,412 (GRCm39) missense probably benign 0.01
R1023:Dync2i1 UTSW 12 116,196,277 (GRCm39) missense probably damaging 1.00
R1065:Dync2i1 UTSW 12 116,219,696 (GRCm39) missense probably damaging 0.98
R1543:Dync2i1 UTSW 12 116,195,404 (GRCm39) splice site probably benign
R1663:Dync2i1 UTSW 12 116,193,230 (GRCm39) missense probably benign 0.01
R1678:Dync2i1 UTSW 12 116,189,590 (GRCm39) missense probably damaging 1.00
R1719:Dync2i1 UTSW 12 116,219,532 (GRCm39) missense probably benign
R1755:Dync2i1 UTSW 12 116,189,649 (GRCm39) missense probably damaging 0.98
R1832:Dync2i1 UTSW 12 116,171,363 (GRCm39) missense probably damaging 0.99
R1918:Dync2i1 UTSW 12 116,196,221 (GRCm39) missense probably damaging 0.96
R2291:Dync2i1 UTSW 12 116,193,191 (GRCm39) splice site probably null
R2444:Dync2i1 UTSW 12 116,196,289 (GRCm39) missense possibly damaging 0.93
R3419:Dync2i1 UTSW 12 116,188,597 (GRCm39) missense probably benign 0.05
R3699:Dync2i1 UTSW 12 116,175,462 (GRCm39) nonsense probably null
R3700:Dync2i1 UTSW 12 116,175,462 (GRCm39) nonsense probably null
R4445:Dync2i1 UTSW 12 116,171,335 (GRCm39) missense probably damaging 1.00
R4664:Dync2i1 UTSW 12 116,219,831 (GRCm39) missense probably damaging 0.99
R4954:Dync2i1 UTSW 12 116,219,645 (GRCm39) missense probably damaging 1.00
R5057:Dync2i1 UTSW 12 116,177,033 (GRCm39) missense probably benign 0.43
R5163:Dync2i1 UTSW 12 116,219,486 (GRCm39) missense possibly damaging 0.76
R5341:Dync2i1 UTSW 12 116,219,534 (GRCm39) missense possibly damaging 0.51
R5560:Dync2i1 UTSW 12 116,181,733 (GRCm39) missense probably damaging 0.98
R5870:Dync2i1 UTSW 12 116,219,865 (GRCm39) missense possibly damaging 0.94
R5925:Dync2i1 UTSW 12 116,197,014 (GRCm39) missense possibly damaging 0.82
R6223:Dync2i1 UTSW 12 116,221,078 (GRCm39) missense possibly damaging 0.95
R6364:Dync2i1 UTSW 12 116,205,352 (GRCm39) missense probably damaging 1.00
R6450:Dync2i1 UTSW 12 116,210,347 (GRCm39) nonsense probably null
R6462:Dync2i1 UTSW 12 116,193,251 (GRCm39) missense probably benign
R6751:Dync2i1 UTSW 12 116,177,076 (GRCm39) missense possibly damaging 0.52
R6896:Dync2i1 UTSW 12 116,193,291 (GRCm39) missense possibly damaging 0.52
R6962:Dync2i1 UTSW 12 116,175,398 (GRCm39) missense probably damaging 1.00
R7033:Dync2i1 UTSW 12 116,175,511 (GRCm39) missense probably benign 0.03
R7042:Dync2i1 UTSW 12 116,218,061 (GRCm39) missense probably benign 0.02
R7567:Dync2i1 UTSW 12 116,218,130 (GRCm39) splice site probably null
R7889:Dync2i1 UTSW 12 116,219,559 (GRCm39) nonsense probably null
R8082:Dync2i1 UTSW 12 116,177,127 (GRCm39) critical splice acceptor site probably null
R8288:Dync2i1 UTSW 12 116,177,345 (GRCm39) missense probably damaging 1.00
R8309:Dync2i1 UTSW 12 116,219,705 (GRCm39) missense probably damaging 1.00
R8682:Dync2i1 UTSW 12 116,188,610 (GRCm39) missense probably damaging 1.00
R8683:Dync2i1 UTSW 12 116,193,262 (GRCm39) missense probably benign 0.03
R8699:Dync2i1 UTSW 12 116,171,321 (GRCm39) missense probably benign 0.01
R8782:Dync2i1 UTSW 12 116,205,332 (GRCm39) missense probably damaging 1.00
R8809:Dync2i1 UTSW 12 116,193,234 (GRCm39) missense probably damaging 0.98
R9281:Dync2i1 UTSW 12 116,211,677 (GRCm39) nonsense probably null
R9530:Dync2i1 UTSW 12 116,175,411 (GRCm39) missense possibly damaging 0.87
R9751:Dync2i1 UTSW 12 116,205,403 (GRCm39) critical splice acceptor site probably null
V7581:Dync2i1 UTSW 12 116,175,460 (GRCm39) missense possibly damaging 0.73
V7582:Dync2i1 UTSW 12 116,175,460 (GRCm39) missense possibly damaging 0.73
V7583:Dync2i1 UTSW 12 116,175,460 (GRCm39) missense possibly damaging 0.73
X0063:Dync2i1 UTSW 12 116,219,489 (GRCm39) missense probably benign
Z1177:Dync2i1 UTSW 12 116,209,719 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAAGGGTCCTTTATAATAGACGCTAAG -3'
(R):5'- CTTTCTTGGCAATGGAGATCGG -3'

Sequencing Primer
(F):5'- gtattgcaccaaaccgga -3'
(R):5'- AATGGAGATCGGGTTCCTCC -3'
Posted On 2019-09-18