Incidental Mutation 'R7146:Tcf12'
ID574600
Institutional Source Beutler Lab
Gene Symbol Tcf12
Ensembl Gene ENSMUSG00000032228
Gene Nametranscription factor 12
SynonymsHTF-4, ALF1, HEB, bHLHb20, HEBAlt, REB, HTF4, ME1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7146 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location71842688-72111871 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to A at 71883103 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034755] [ENSMUST00000183404] [ENSMUST00000183492] [ENSMUST00000183594] [ENSMUST00000183918] [ENSMUST00000183992] [ENSMUST00000184072] [ENSMUST00000184107] [ENSMUST00000184416] [ENSMUST00000184448] [ENSMUST00000184523] [ENSMUST00000184783] [ENSMUST00000184867] [ENSMUST00000185117]
Predicted Effect probably null
Transcript: ENSMUST00000034755
SMART Domains Protein: ENSMUSP00000034755
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000183404
SMART Domains Protein: ENSMUSP00000139365
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183492
SMART Domains Protein: ENSMUSP00000138939
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183594
Predicted Effect probably benign
Transcript: ENSMUST00000183647
Predicted Effect probably null
Transcript: ENSMUST00000183918
SMART Domains Protein: ENSMUSP00000138978
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 86 102 N/A INTRINSIC
low complexity region 182 193 N/A INTRINSIC
low complexity region 388 402 N/A INTRINSIC
HLH 437 490 7.54e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000183992
SMART Domains Protein: ENSMUSP00000139084
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 5e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184029
Predicted Effect probably null
Transcript: ENSMUST00000184072
SMART Domains Protein: ENSMUSP00000139284
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 85 108 4e-8 PDB
low complexity region 116 127 N/A INTRINSIC
low complexity region 164 180 N/A INTRINSIC
low complexity region 260 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184107
Predicted Effect probably benign
Transcript: ENSMUST00000184378
Predicted Effect probably benign
Transcript: ENSMUST00000184416
Predicted Effect probably null
Transcript: ENSMUST00000184448
SMART Domains Protein: ENSMUSP00000139334
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 86 102 N/A INTRINSIC
low complexity region 182 193 N/A INTRINSIC
low complexity region 364 378 N/A INTRINSIC
HLH 413 466 7.54e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000184523
SMART Domains Protein: ENSMUSP00000138832
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 173 196 6e-8 PDB
low complexity region 204 215 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
low complexity region 348 359 N/A INTRINSIC
low complexity region 554 568 N/A INTRINSIC
HLH 603 656 7.54e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000184783
SMART Domains Protein: ENSMUSP00000139364
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184867
Predicted Effect probably null
Transcript: ENSMUST00000185117
SMART Domains Protein: ENSMUSP00000138925
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 534 548 N/A INTRINSIC
HLH 583 636 7.54e-10 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 95% (99/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. This encoded protein is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit postnatal lethality within two weeks of birth and a 50% reduction in the number of pro-B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,255,297 I895F probably benign Het
Abca16 A G 7: 120,527,751 N1222D possibly damaging Het
Abcc4 A T 14: 118,615,181 Y499N probably damaging Het
Adgrg7 A C 16: 56,730,242 C702W probably damaging Het
Adk C A 14: 21,326,614 P27H Het
Ankrd13a T C 5: 114,775,232 S2P probably damaging Het
Ano1 T C 7: 144,655,656 H269R probably benign Het
Aox3 T A 1: 58,158,529 probably null Het
Asl G A 5: 130,024,449 probably benign Het
Asxl2 A T 12: 3,457,066 D86V probably damaging Het
Ate1 A T 7: 130,481,778 probably null Het
Bach2 A G 4: 32,562,670 D379G probably damaging Het
Bdkrb1 T A 12: 105,604,883 L236Q probably damaging Het
Cacna2d3 T C 14: 29,721,697 Y24C unknown Het
Cage1 G T 13: 38,023,049 N273K probably benign Het
Ccdc51 T A 9: 109,091,780 I245N probably damaging Het
Cep152 T C 2: 125,614,405 I229V probably benign Het
Chst4 T A 8: 110,030,731 S167C probably damaging Het
Cntnap4 A T 8: 112,810,636 Y713F probably damaging Het
Cntnap5b G A 1: 100,050,794 probably null Het
Cog8 G T 8: 107,052,373 T424K possibly damaging Het
Cop1 T G 1: 159,244,352 probably null Het
Cyp2j6 A G 4: 96,545,782 I97T probably damaging Het
D430041D05Rik T C 2: 104,258,353 T131A probably benign Het
Dnah17 T C 11: 118,082,110 D1999G probably damaging Het
Dnah8 A G 17: 30,644,617 D250G probably benign Het
Dnah8 T C 17: 30,769,644 V3196A possibly damaging Het
Dscam A T 16: 96,829,917 Y299* probably null Het
Ephb1 A G 9: 101,963,958 S774P probably damaging Het
Fat1 G A 8: 44,950,925 V238I probably benign Het
Fermt1 C T 2: 132,934,865 M234I probably benign Het
Fmnl2 C T 2: 53,068,540 S212L Het
Frem1 T C 4: 82,922,295 N1798S possibly damaging Het
Gabrd T A 4: 155,385,406 M449L probably benign Het
Gad1 T C 2: 70,587,362 F302L probably benign Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm11639 A G 11: 104,967,752 N3879S unknown Het
Gm11639 A C 11: 105,022,938 D4594A probably benign Het
Gm21886 GGGCCTGCAGACAGTAGGTGCTCACTAGGGCCTGTAAATAGTAGGTGCTCACTGAGGCCTGTAGACAGTAGGTGCTCA GGGCCTGTAGACAGTAGGTGCTCA 18: 80,089,482 probably benign Het
Gnb3 C T 6: 124,836,924 probably null Het
Gtf3c1 A T 7: 125,672,821 M642K possibly damaging Het
Hps3 A T 3: 20,008,886 W838R probably damaging Het
Ide A T 19: 37,295,944 W527R Het
Ighe A T 12: 113,272,355 I117N Het
Ighv1-50 T C 12: 115,119,776 E108G probably benign Het
Ivl G A 3: 92,572,231 P176S probably damaging Het
Lamb2 T A 9: 108,484,084 L605Q possibly damaging Het
Lgi3 G A 14: 70,533,392 R157H probably damaging Het
Lrp1b G T 2: 41,375,994 C1053* probably null Het
Mcpt9 A T 14: 56,026,988 S217T probably damaging Het
Mgat4c T G 10: 102,388,496 N190K probably damaging Het
Mknk1 T A 4: 115,864,592 V111D probably damaging Het
Mmp11 T C 10: 75,928,446 T62A probably benign Het
Mmp1b C A 9: 7,385,014 V212F probably damaging Het
Mmp7 A G 9: 7,697,586 probably null Het
Muc5b C T 7: 141,863,967 T3550M possibly damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nphp3 A T 9: 104,004,837 K169* probably null Het
Npy6r G T 18: 44,275,721 V70F probably benign Het
Nsun2 T A 13: 69,626,553 probably null Het
Oplah T A 15: 76,302,660 I652F probably benign Het
Pcdh18 T C 3: 49,755,822 N348S probably damaging Het
Pcdhb5 T A 18: 37,321,356 V263D probably damaging Het
Pcdhga1 C A 18: 37,662,111 T56N probably benign Het
Pdk4 A G 6: 5,491,068 probably null Het
Pfkp C A 13: 6,602,781 V434F probably benign Het
Phospho1 G A 11: 95,830,906 R134H probably damaging Het
Polg2 G T 11: 106,772,746 Q374K probably benign Het
Ptpra T C 2: 130,537,651 probably null Het
Rassf3 C T 10: 121,416,147 E120K probably benign Het
Reln A T 5: 22,106,097 S273T probably damaging Het
Scarb1 C T 5: 125,284,025 A133T probably benign Het
Scn3a T A 2: 65,483,142 K1142N probably damaging Het
Sema3c G A 5: 17,694,703 V398I probably benign Het
Serpine1 C A 5: 137,071,064 Q80H probably damaging Het
Sh3gl1 G A 17: 56,017,646 T334M probably damaging Het
Smg7 T C 1: 152,861,825 N122D probably benign Het
Speer4b T C 5: 27,498,710 I144V probably benign Het
Spire2 T A 8: 123,369,250 D671E probably benign Het
Sspo A T 6: 48,501,095 H5144L probably benign Het
Sstr2 A T 11: 113,625,353 Q366L probably damaging Het
Ssu72 T C 4: 155,731,393 F98S probably damaging Het
Syde2 C T 3: 146,007,115 Q1003* probably null Het
Tapbp G A 17: 33,925,487 A186T possibly damaging Het
Tnfrsf22 A T 7: 143,640,819 C124S probably damaging Het
Txlnb A T 10: 17,827,798 T235S possibly damaging Het
Uaca T C 9: 60,870,413 L694P probably damaging Het
Unc13a T A 8: 71,630,553 N1620Y probably damaging Het
Vmn2r10 C T 5: 109,003,334 C138Y probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r28 T A 7: 5,481,496 E568D probably benign Het
Vmn2r57 A T 7: 41,448,471 H57Q possibly damaging Het
Vwa5b1 A G 4: 138,581,612 S756P probably benign Het
Washc5 C A 15: 59,352,501 E470* probably null Het
Xpot A T 10: 121,606,773 V508D probably damaging Het
Zfp616 A T 11: 74,085,261 K785N possibly damaging Het
Zfp653 T C 9: 22,065,899 N119D probably damaging Het
Zfp729b A G 13: 67,593,376 S257P probably damaging Het
Zfp82 T A 7: 30,056,167 T497S probably benign Het
Znrf4 T G 17: 56,512,305 M1L probably benign Het
Other mutations in Tcf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Tcf12 APN 9 71868118 missense probably damaging 0.98
IGL01311:Tcf12 APN 9 71858656 splice site probably benign
IGL01734:Tcf12 APN 9 71922648 splice site probably null
IGL01768:Tcf12 APN 9 71868996 splice site probably null
IGL02625:Tcf12 APN 9 71922757 missense probably damaging 1.00
IGL02671:Tcf12 APN 9 72109717 missense probably damaging 1.00
IGL03395:Tcf12 APN 9 71876022 missense probably damaging 1.00
Beneath UTSW 9 71883103 splice site probably null
Poorly UTSW 9 71944016 nonsense probably null
Poorly2 UTSW 9 71858929 missense probably damaging 1.00
Poorly3 UTSW 9 72015636 critical splice donor site probably null
Substandard UTSW 9 71858840 missense probably null 0.54
R0183:Tcf12 UTSW 9 71917027 missense probably damaging 0.99
R0257:Tcf12 UTSW 9 71858622 missense probably benign 0.05
R1126:Tcf12 UTSW 9 72000433 missense probably benign 0.09
R1520:Tcf12 UTSW 9 71883106 critical splice donor site probably null
R1690:Tcf12 UTSW 9 71870072 critical splice donor site probably null
R1819:Tcf12 UTSW 9 72109717 missense probably damaging 1.00
R1850:Tcf12 UTSW 9 71868215 missense probably damaging 1.00
R1888:Tcf12 UTSW 9 71858534 missense possibly damaging 0.89
R1888:Tcf12 UTSW 9 71858534 missense possibly damaging 0.89
R2402:Tcf12 UTSW 9 71856510 missense probably damaging 1.00
R4445:Tcf12 UTSW 9 71869063 missense probably damaging 0.99
R4693:Tcf12 UTSW 9 71868967 intron probably benign
R4814:Tcf12 UTSW 9 71870041 intron probably benign
R4860:Tcf12 UTSW 9 71858840 missense probably null 0.54
R4860:Tcf12 UTSW 9 71858840 missense probably null 0.54
R4885:Tcf12 UTSW 9 71858840 missense probably null 0.54
R5347:Tcf12 UTSW 9 71885243 missense probably damaging 1.00
R5422:Tcf12 UTSW 9 71869038 missense probably damaging 1.00
R5650:Tcf12 UTSW 9 71885302 splice site probably null
R5713:Tcf12 UTSW 9 71885263 makesense probably null
R5789:Tcf12 UTSW 9 71885236 missense probably damaging 1.00
R5964:Tcf12 UTSW 9 71868240 missense probably damaging 1.00
R6012:Tcf12 UTSW 9 71858947 missense possibly damaging 0.62
R6119:Tcf12 UTSW 9 71868265 missense probably damaging 1.00
R6240:Tcf12 UTSW 9 71944016 nonsense probably null
R6299:Tcf12 UTSW 9 71858929 missense probably damaging 1.00
R6449:Tcf12 UTSW 9 71868268 missense probably damaging 1.00
R6489:Tcf12 UTSW 9 72015636 critical splice donor site probably null
R6984:Tcf12 UTSW 9 72006759 nonsense probably null
R7734:Tcf12 UTSW 9 71922661 missense probably benign 0.00
R7955:Tcf12 UTSW 9 71870070 splice site probably null
X0021:Tcf12 UTSW 9 71883172 missense probably damaging 0.99
X0022:Tcf12 UTSW 9 72109743 missense probably damaging 0.99
Z1177:Tcf12 UTSW 9 72000460 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TCACAGTGAATCGGGAACACTC -3'
(R):5'- GAACACATGTGATATGATCTGTCTC -3'

Sequencing Primer
(F):5'- GAATCGGGAACACTCTTATGTGC -3'
(R):5'- ACATGTGATATGATCTGTCTCTTTTC -3'
Posted On2019-09-23