Incidental Mutation 'R7236:Mtmr10'
ID574609
Institutional Source Beutler Lab
Gene Symbol Mtmr10
Ensembl Gene ENSMUSG00000030522
Gene Namemyotubularin related protein 10
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R7236 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location64287653-64340806 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to C at 64314184 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032736] [ENSMUST00000206452]
Predicted Effect silent
Transcript: ENSMUST00000032736
SMART Domains Protein: ENSMUSP00000032736
Gene: ENSMUSG00000030522

DomainStartEndE-ValueType
Pfam:Myotub-related 176 330 8.6e-12 PFAM
Pfam:Myotub-related 319 508 2.7e-56 PFAM
Pfam:3-PAP 570 701 2.2e-57 PFAM
low complexity region 730 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206452
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 C T 19: 4,871,616 V179I probably benign Het
Adra1b A G 11: 43,776,324 I362T possibly damaging Het
B3galnt1 T C 3: 69,575,617 K104E probably benign Het
Bnc2 T C 4: 84,555,864 Y15C probably benign Het
C2cd2l C A 9: 44,317,663 A124S possibly damaging Het
Camsap3 T A 8: 3,604,116 F595L probably damaging Het
Cct2 A T 10: 117,061,559 D93E probably benign Het
Cemip A T 7: 83,948,804 probably null Het
Ciapin1 T C 8: 94,823,710 T34A Het
Dopey1 G A 9: 86,515,378 V912I probably damaging Het
Eif3c T C 7: 126,552,323 T610A possibly damaging Het
Ephb3 A G 16: 21,214,481 R106G probably damaging Het
Ephx3 T A 17: 32,185,354 probably null Het
Etv2 A T 7: 30,635,030 S93T probably benign Het
Fbxo34 T A 14: 47,530,384 D451E probably benign Het
Fmo9 A G 1: 166,676,571 F141L probably damaging Het
Fryl T C 5: 73,108,478 K500R possibly damaging Het
Gfra3 T C 18: 34,695,831 D170G probably damaging Het
Gm11639 A T 11: 104,899,267 Q2832L probably benign Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gm17783 A T 16: 45,527,667 I169N possibly damaging Het
Gm4869 G T 5: 140,471,645 A390S probably benign Het
Gnptg T C 17: 25,239,923 N34S possibly damaging Het
Golga5 T A 12: 102,474,775 probably null Het
Herc2 G T 7: 56,085,080 L139F probably benign Het
Ikzf2 T A 1: 69,539,081 N423I probably benign Het
Il31ra A T 13: 112,523,905 *717R probably null Het
Itga2 G T 13: 114,877,691 Q234K probably benign Het
Kcnt1 A T 2: 25,909,939 probably null Het
Man2a2 T C 7: 80,368,905 S69G probably damaging Het
Mccc1 A G 3: 35,983,795 V294A probably benign Het
Mphosph8 T A 14: 56,674,297 I259K possibly damaging Het
Mrpl15 A T 1: 4,776,488 N288K probably benign Het
Msantd2 T C 9: 37,489,669 W116R probably damaging Het
Mylk A T 16: 34,922,529 D1137V probably damaging Het
Nhsl1 A G 10: 18,525,764 K879E probably damaging Het
Olfr1062 A T 2: 86,423,189 C162* probably null Het
Pak6 A G 2: 118,693,428 T355A probably benign Het
Patj C T 4: 98,411,057 R139C probably damaging Het
Pcdhb3 C T 18: 37,301,452 A157V probably damaging Het
Phkg1 C A 5: 129,866,961 D150Y probably damaging Het
Ppp2r5c C T 12: 110,465,889 S45L probably benign Het
Prl4a1 A C 13: 28,018,573 T44P probably benign Het
Ptpro G A 6: 137,368,337 V114M probably damaging Het
Pwp1 A G 10: 85,879,283 N211S probably benign Het
Ralgapb A G 2: 158,440,827 D504G probably benign Het
Rock2 A T 12: 16,929,002 I98F probably damaging Het
Senp6 G T 9: 80,132,965 V785L probably damaging Het
Simc1 A G 13: 54,524,796 D319G probably benign Het
Tas2r105 A T 6: 131,686,760 I235N probably damaging Het
Tas2r110 A T 6: 132,868,704 M233L possibly damaging Het
Tmem260 C T 14: 48,509,190 probably null Het
Trank1 G T 9: 111,373,074 V1590L possibly damaging Het
Tsc2 A T 17: 24,623,594 M286K possibly damaging Het
Ttn T C 2: 76,867,452 T202A Het
Ttyh1 A G 7: 4,133,664 N424D probably benign Het
Usp24 T A 4: 106,406,305 probably null Het
Utp20 G T 10: 88,749,342 P2620Q probably benign Het
Vmn1r45 A G 6: 89,933,151 M279T probably benign Het
Vmn2r115 T A 17: 23,359,602 I683K probably benign Het
Vmn2r34 T C 7: 7,681,751 K481E probably damaging Het
Vmn2r54 T A 7: 12,631,990 H339L possibly damaging Het
Vmn2r94 T A 17: 18,257,549 N200I possibly damaging Het
Wdfy3 A G 5: 101,836,208 Y3493H probably damaging Het
Wdr5b A G 16: 36,041,838 D109G possibly damaging Het
Zfp286 A T 11: 62,783,670 probably null Het
Other mutations in Mtmr10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01999:Mtmr10 APN 7 64337712 missense probably benign
IGL02082:Mtmr10 APN 7 64333490 splice site probably benign
IGL02234:Mtmr10 APN 7 64299602 missense probably benign 0.04
IGL02448:Mtmr10 APN 7 64308150 missense probably damaging 1.00
IGL02515:Mtmr10 APN 7 64337511 missense probably damaging 1.00
Curlyq UTSW 7 64333439 missense probably damaging 1.00
K7371:Mtmr10 UTSW 7 64314210 missense probably benign 0.18
PIT4472001:Mtmr10 UTSW 7 64333358 missense probably benign 0.23
R0302:Mtmr10 UTSW 7 64297497 missense probably damaging 1.00
R0619:Mtmr10 UTSW 7 64321213 missense probably benign 0.00
R0787:Mtmr10 UTSW 7 64300615 missense possibly damaging 0.95
R0972:Mtmr10 UTSW 7 64326709 missense probably damaging 1.00
R1482:Mtmr10 UTSW 7 64314249 missense probably damaging 1.00
R1770:Mtmr10 UTSW 7 64336721 missense possibly damaging 0.47
R1826:Mtmr10 UTSW 7 64337466 missense probably benign 0.00
R2174:Mtmr10 UTSW 7 64336764 missense possibly damaging 0.94
R2215:Mtmr10 UTSW 7 64337655 missense probably benign 0.00
R2352:Mtmr10 UTSW 7 64297580 missense possibly damaging 0.71
R2411:Mtmr10 UTSW 7 64297497 missense probably damaging 1.00
R3702:Mtmr10 UTSW 7 64337899 missense probably damaging 1.00
R3710:Mtmr10 UTSW 7 64326685 missense possibly damaging 0.86
R3802:Mtmr10 UTSW 7 64320628 missense probably benign 0.29
R4190:Mtmr10 UTSW 7 64314186 missense probably benign 0.37
R4484:Mtmr10 UTSW 7 64320631 missense possibly damaging 0.86
R4562:Mtmr10 UTSW 7 64314159 missense possibly damaging 0.92
R5128:Mtmr10 UTSW 7 64333439 missense probably damaging 1.00
R5203:Mtmr10 UTSW 7 64318161 missense probably benign
R5444:Mtmr10 UTSW 7 64288401 unclassified probably null
R5627:Mtmr10 UTSW 7 64336752 missense probably damaging 1.00
R5786:Mtmr10 UTSW 7 64337710 missense probably damaging 1.00
R7078:Mtmr10 UTSW 7 64320627 missense possibly damaging 0.65
R7575:Mtmr10 UTSW 7 64297465 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAATTTTAGACGCAGAAGGCC -3'
(R):5'- TCTTCACAGAGGTCTTTTCCAG -3'

Sequencing Primer
(F):5'- GGCCACACATAGGACATGTATG -3'
(R):5'- CACAGAGGTCTTTTCCAGGTGTG -3'
Posted On2019-09-23