Incidental Mutation 'R7237:Wdr62'
List |< first << previous [record 83 of 85] next >> last >|
ID574622
Institutional Source Beutler Lab
Gene Symbol Wdr62
Ensembl Gene ENSMUSG00000037020
Gene NameWD repeat domain 62
Synonyms2310038K02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7237 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location30240138-30280419 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to C at 30270444 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108190] [ENSMUST00000145027]
Predicted Effect probably null
Transcript: ENSMUST00000108190
SMART Domains Protein: ENSMUSP00000103825
Gene: ENSMUSG00000037020

DomainStartEndE-ValueType
low complexity region 27 53 N/A INTRINSIC
WD40 101 142 4.24e-3 SMART
WD40 145 186 1.03e-1 SMART
WD40 189 226 7.4e0 SMART
WD40 284 322 3.55e1 SMART
WD40 353 388 1.85e0 SMART
WD40 395 442 2.98e-1 SMART
WD40 482 521 2.77e-1 SMART
WD40 524 566 2.3e0 SMART
WD40 570 610 4.18e-2 SMART
WD40 615 657 1.54e0 SMART
WD40 660 702 8.49e-3 SMART
WD40 705 744 3.61e-6 SMART
low complexity region 763 768 N/A INTRINSIC
low complexity region 797 811 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
low complexity region 1215 1226 N/A INTRINSIC
low complexity region 1302 1313 N/A INTRINSIC
low complexity region 1477 1497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145027
SMART Domains Protein: ENSMUSP00000116772
Gene: ENSMUSG00000037020

DomainStartEndE-ValueType
low complexity region 27 53 N/A INTRINSIC
WD40 101 142 4.24e-3 SMART
WD40 145 186 1.03e-1 SMART
WD40 189 226 7.4e0 SMART
WD40 284 322 3.55e1 SMART
WD40 353 388 1.85e0 SMART
WD40 395 442 2.98e-1 SMART
WD40 482 521 2.77e-1 SMART
WD40 524 566 2.3e0 SMART
WD40 570 610 4.18e-2 SMART
WD40 615 657 1.54e0 SMART
WD40 660 702 8.49e-3 SMART
WD40 705 744 3.61e-6 SMART
low complexity region 763 768 N/A INTRINSIC
low complexity region 797 811 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is proposed to play a role in cerebral cortical development. Mutations in this gene have been associated with microencephaly, cortical malformations, and mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice for a hypomorphic allele exhibit reduced brain size due to decreased neural progenitor cells. Cells show spindle instability, spindle assembly checkpoint activation, mitotic arrest and cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 A T 2: 20,849,972 C1536* probably null Het
Armc9 C A 1: 86,164,849 Q169K possibly damaging Het
Aspm T A 1: 139,477,929 M1518K possibly damaging Het
AU018091 A G 7: 3,159,166 I360T probably benign Het
BB014433 C A 8: 15,041,765 V363L probably benign Het
Bcam T C 7: 19,769,307 probably null Het
Cacna1g T C 11: 94,437,879 S1071G probably benign Het
Card9 A T 2: 26,356,775 S354T probably benign Het
Ccdc87 A G 19: 4,839,762 N94S probably benign Het
Cdc27 A G 11: 104,517,419 V555A probably benign Het
Coro1a T A 7: 126,700,306 D411V probably benign Het
Cybrd1 GGTCCTGCAC G 2: 71,118,209 probably benign Het
Cyth1 A T 11: 118,185,495 I95N probably damaging Het
Ddx58 T A 4: 40,205,938 I885F probably benign Het
Dnah7b A T 1: 46,139,966 E933V probably damaging Het
Dync2h1 A T 9: 6,993,966 I3968N probably benign Het
Fam126b G A 1: 58,529,948 Q491* probably null Het
Fam184a T C 10: 53,634,393 probably benign Het
Fat3 G A 9: 16,377,214 L338F probably damaging Het
Fcgr3 A G 1: 171,059,301 L18P probably damaging Het
Gbp5 T C 3: 142,507,700 V459A probably benign Het
Gja4 A T 4: 127,312,163 M269K probably benign Het
Gm4787 A G 12: 81,377,668 V572A probably damaging Het
Grin2d G T 7: 45,866,176 S131* probably null Het
Gys1 A G 7: 45,455,162 D671G probably benign Het
Haspin T C 11: 73,136,886 N459S probably benign Het
Hdac10 G T 15: 89,125,377 Q451K probably benign Het
Hdac9 T C 12: 34,374,140 probably null Het
Hmcn1 A G 1: 150,722,643 V1636A probably damaging Het
Hpca A G 4: 129,118,614 L43P probably damaging Het
Insm1 C A 2: 146,222,528 A88E possibly damaging Het
Itga9 A G 9: 118,636,602 K175E probably benign Het
Kif13a A G 13: 46,809,156 probably null Het
Kif20b T A 19: 34,950,605 L1089H probably damaging Het
Lamp5 A T 2: 136,059,835 H152L probably benign Het
Lrp4 T C 2: 91,473,183 F76L probably benign Het
Magi3 T C 3: 104,027,911 D902G probably damaging Het
Map10 C T 8: 125,671,224 P452L probably benign Het
Mapk6 A G 9: 75,397,613 L174P probably damaging Het
Ndufa4 C T 6: 11,906,019 probably null Het
Nedd4 A T 9: 72,725,064 E393D probably benign Het
Nlrp4b G A 7: 10,715,216 V449I probably benign Het
Nufip2 T A 11: 77,692,770 N503K probably benign Het
Olfr220 C T 1: 174,449,339 R239C probably benign Het
Olfr455 T C 6: 42,538,647 D125G probably damaging Het
P4ha1 A G 10: 59,348,243 T176A probably benign Het
Palm3 A G 8: 84,029,488 K543R probably benign Het
Parvg G A 15: 84,341,356 A302T probably benign Het
Pcdh15 A G 10: 74,584,191 D1227G possibly damaging Het
Pdzd8 C T 19: 59,345,139 G150D probably damaging Het
Pitpnm2 A G 5: 124,125,297 probably null Het
Pld5 T C 1: 176,274,735 Q47R possibly damaging Het
Ppp2r5d T C 17: 46,686,280 S329G possibly damaging Het
Prss56 T C 1: 87,184,915 V144A probably damaging Het
Psg28 A T 7: 18,427,844 Y245N possibly damaging Het
Ptpn3 C T 4: 57,239,625 V302I probably damaging Het
Ptprn2 A G 12: 117,161,727 H627R probably benign Het
Rasgrp2 A T 19: 6,404,808 H226L possibly damaging Het
Rbm20 C T 19: 53,851,499 T973M probably benign Het
Riok2 T A 17: 17,377,783 L44Q probably damaging Het
Rusc1 G T 3: 89,091,498 Q326K possibly damaging Het
Sart3 A T 5: 113,754,246 H397Q possibly damaging Het
Sec31b T A 19: 44,517,708 T920S probably damaging Het
Serpinb13 A G 1: 106,998,949 E225G probably damaging Het
Slc25a47 T C 12: 108,855,460 L165P probably damaging Het
Slc2a10 G A 2: 165,515,277 V286I probably benign Het
Slc39a13 G T 2: 91,065,634 T174N probably benign Het
Slc7a13 T A 4: 19,839,364 N322K probably benign Het
Stk38 T C 17: 28,974,646 T326A possibly damaging Het
Sult1a1 T C 7: 126,673,450 M244V probably benign Het
Tas2r144 C T 6: 42,215,866 T180I probably damaging Het
Tbc1d12 T A 19: 38,898,902 M366K probably benign Het
Terb1 T C 8: 104,495,327 I147V possibly damaging Het
Tldc1 C T 8: 119,762,315 G410S probably damaging Het
Tmem5 A T 10: 122,081,618 L330* probably null Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Tnxb C A 17: 34,682,196 L995I possibly damaging Het
Trim34b A G 7: 104,329,587 T14A possibly damaging Het
Urb1 T C 16: 90,791,166 E418G probably damaging Het
Vmn1r12 T A 6: 57,159,565 C216S possibly damaging Het
Vmn2r90 T A 17: 17,703,987 V16E possibly damaging Het
Vps11 A T 9: 44,354,506 V492D probably damaging Het
Zc3h14 T A 12: 98,780,149 M539K probably benign Het
Zfp871 A T 17: 32,775,315 H295Q probably damaging Het
Other mutations in Wdr62
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Wdr62 APN 7 30243523 missense probably benign 0.00
IGL00428:Wdr62 APN 7 30270752 missense probably damaging 0.99
IGL00579:Wdr62 APN 7 30267895 missense probably damaging 1.00
IGL00709:Wdr62 APN 7 30242061 missense probably benign 0.05
IGL00924:Wdr62 APN 7 30265218 missense probably damaging 0.99
IGL00924:Wdr62 APN 7 30242806 missense probably damaging 1.00
IGL00956:Wdr62 APN 7 30261339 missense probably damaging 0.96
IGL01016:Wdr62 APN 7 30254251 missense probably benign 0.39
IGL01118:Wdr62 APN 7 30242781 missense probably damaging 0.96
IGL01458:Wdr62 APN 7 30241762 missense probably benign 0.08
IGL01977:Wdr62 APN 7 30258101 missense probably damaging 1.00
IGL02065:Wdr62 APN 7 30243469 missense possibly damaging 0.59
IGL02155:Wdr62 APN 7 30262643 missense probably damaging 1.00
IGL02260:Wdr62 APN 7 30270782 missense probably damaging 1.00
IGL02404:Wdr62 APN 7 30267873 missense probably damaging 1.00
IGL02491:Wdr62 APN 7 30242759 missense probably benign 0.19
IGL02556:Wdr62 APN 7 30245284 splice site probably null
IGL02739:Wdr62 APN 7 30242460 nonsense probably null
IGL03387:Wdr62 APN 7 30270774 missense possibly damaging 0.90
I0000:Wdr62 UTSW 7 30245327 missense probably benign 0.03
R0304:Wdr62 UTSW 7 30242874 missense probably benign 0.20
R0371:Wdr62 UTSW 7 30242158 missense possibly damaging 0.56
R0400:Wdr62 UTSW 7 30241462 missense possibly damaging 0.81
R0621:Wdr62 UTSW 7 30254061 missense possibly damaging 0.94
R0634:Wdr62 UTSW 7 30270174 missense probably damaging 0.98
R1758:Wdr62 UTSW 7 30267903 missense probably damaging 1.00
R2205:Wdr62 UTSW 7 30258149 critical splice acceptor site probably null
R2254:Wdr62 UTSW 7 30267903 missense probably damaging 0.97
R2255:Wdr62 UTSW 7 30267903 missense probably damaging 0.97
R2566:Wdr62 UTSW 7 30273999 missense probably damaging 1.00
R2851:Wdr62 UTSW 7 30261437 missense possibly damaging 0.70
R3150:Wdr62 UTSW 7 30271670 missense possibly damaging 0.94
R4355:Wdr62 UTSW 7 30242248 missense probably damaging 1.00
R4517:Wdr62 UTSW 7 30270258 missense probably damaging 1.00
R4839:Wdr62 UTSW 7 30241465 missense probably benign 0.00
R4839:Wdr62 UTSW 7 30270686 missense probably damaging 1.00
R5193:Wdr62 UTSW 7 30265167 missense probably damaging 0.99
R5289:Wdr62 UTSW 7 30267875 missense probably damaging 1.00
R5306:Wdr62 UTSW 7 30265263 missense possibly damaging 0.94
R5878:Wdr62 UTSW 7 30241347 missense probably benign
R5942:Wdr62 UTSW 7 30243079 nonsense probably null
R6051:Wdr62 UTSW 7 30261384 missense possibly damaging 0.69
R6237:Wdr62 UTSW 7 30242435 missense probably damaging 1.00
R6727:Wdr62 UTSW 7 30271620 missense probably damaging 1.00
R7158:Wdr62 UTSW 7 30270738 missense possibly damaging 0.77
R7208:Wdr62 UTSW 7 30252336 missense probably damaging 0.97
R7336:Wdr62 UTSW 7 30243917 missense probably damaging 0.98
R7559:Wdr62 UTSW 7 30270773 missense probably damaging 0.98
R7845:Wdr62 UTSW 7 30265242 missense possibly damaging 0.79
R7928:Wdr62 UTSW 7 30265242 missense possibly damaging 0.79
R8002:Wdr62 UTSW 7 30252360 missense probably damaging 1.00
Z1176:Wdr62 UTSW 7 30255928 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGTTGTGCAGCTCACCCAG -3'
(R):5'- TTTTGCACCCATTATGGTCAGGTC -3'

Sequencing Primer
(F):5'- TGCAGCTCACCCAGGATGC -3'
(R):5'- ACCCATTATGGTCAGGTCTCAGAG -3'
Posted On2019-09-23