Incidental Mutation 'R7269:Skint6'
ID 574626
Institutional Source Beutler Lab
Gene Symbol Skint6
Ensembl Gene ENSMUSG00000087194
Gene Name selection and upkeep of intraepithelial T cells 6
Synonyms OTTMUSG00000008519
MMRRC Submission 045320-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R7269 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 112661813-113144170 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 112711686 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]
AlphaFold A7XUZ6
Predicted Effect probably null
Transcript: ENSMUST00000138966
SMART Domains Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171224
SMART Domains Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (85/87)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A T 18: 24,606,013 (GRCm39) N36I probably damaging Het
A430033K04Rik T A 5: 138,645,014 (GRCm39) Y300N possibly damaging Het
Adipor2 T C 6: 119,347,205 (GRCm39) Q26R probably benign Het
Ahnak T A 19: 8,983,981 (GRCm39) M1755K probably damaging Het
Ahnak2 A T 12: 112,780,802 (GRCm38) V70E Het
AI837181 C A 19: 5,476,462 (GRCm39) S208R probably damaging Het
Arhgap35 T G 7: 16,295,652 (GRCm39) M1138L probably benign Het
Card14 T G 11: 119,228,573 (GRCm39) L633R probably damaging Het
Carmil3 A G 14: 55,731,352 (GRCm39) T144A probably benign Het
Cbfa2t2 T A 2: 154,357,895 (GRCm39) N223K probably benign Het
Ccdc39 T C 3: 33,884,254 (GRCm39) I363V probably benign Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Ccpg1 G T 9: 72,920,609 (GRCm39) R741S probably benign Het
Cenpc1 A G 5: 86,161,366 (GRCm39) F855L probably damaging Het
Cenpc1 A T 5: 86,180,277 (GRCm39) M665K probably benign Het
Cp A G 3: 20,037,641 (GRCm39) H832R probably damaging Het
Defa24 A G 8: 22,224,565 (GRCm39) I5V probably benign Het
Dlc1 A C 8: 37,046,407 (GRCm39) L730R probably damaging Het
Dmbt1 A T 7: 130,668,351 (GRCm39) I536F unknown Het
Dscam G A 16: 96,479,601 (GRCm39) T1182I probably benign Het
Eea1 A T 10: 95,854,000 (GRCm39) I553F probably damaging Het
Far1 T C 7: 113,160,654 (GRCm39) V400A probably benign Het
Fbrsl1 A T 5: 110,580,880 (GRCm39) S126T probably benign Het
Frmpd2 A T 14: 33,244,838 (GRCm39) E552V possibly damaging Het
Gm5431 T A 11: 48,779,237 (GRCm39) T562S probably benign Het
Gm5475 T C 15: 100,324,890 (GRCm39) F106S unknown Het
Gpr12 T C 5: 146,520,188 (GRCm39) T245A probably damaging Het
Gsta2 A G 9: 78,239,419 (GRCm39) Y166H probably benign Het
H6pd A G 4: 150,067,369 (GRCm39) V347A probably benign Het
Ifih1 T C 2: 62,475,977 (GRCm39) T100A probably benign Het
Ift70b A G 2: 75,767,838 (GRCm39) F305S probably damaging Het
Itga2 C T 13: 115,023,225 (GRCm39) W59* probably null Het
Knstrn T A 2: 118,661,869 (GRCm39) probably null Het
Kprp A G 3: 92,731,178 (GRCm39) V624A probably damaging Het
Lmbrd2 A G 15: 9,194,771 (GRCm39) Y591C probably damaging Het
Map7d1 A G 4: 126,126,666 (GRCm39) V842A unknown Het
Mboat2 A T 12: 24,881,708 (GRCm39) T4S probably benign Het
Mcph1 T A 8: 18,657,288 (GRCm39) probably null Het
Mrtfb A T 16: 13,218,898 (GRCm39) M515L possibly damaging Het
Muc5b A G 7: 141,411,272 (GRCm39) D1406G unknown Het
Mylk G A 16: 34,605,381 (GRCm39) G3D probably damaging Het
Ndst4 A G 3: 125,232,007 (GRCm39) D192G probably damaging Het
Nemp1 G T 10: 127,531,345 (GRCm39) R361L probably damaging Het
Nol4 A C 18: 23,172,846 (GRCm39) V85G probably benign Het
Nrbf2 G A 10: 67,103,605 (GRCm39) T166M probably damaging Het
Obscn T C 11: 58,933,838 (GRCm39) E5342G probably damaging Het
Or10al7 C A 17: 38,366,442 (GRCm39) C5F probably damaging Het
Or4f47 T A 2: 111,972,905 (GRCm39) F205Y probably damaging Het
Or4p19 C T 2: 88,242,839 (GRCm39) M54I possibly damaging Het
Or51d1 T G 7: 102,348,252 (GRCm39) L269R probably damaging Het
Or7d10 A G 9: 19,831,631 (GRCm39) N42S possibly damaging Het
Pakap G T 4: 57,855,217 (GRCm39) R182L probably damaging Het
Pde4dip A G 3: 97,674,275 (GRCm39) S214P probably damaging Het
Per3 A T 4: 151,116,393 (GRCm39) C278* probably null Het
Pi4k2a T C 19: 42,079,125 (GRCm39) L62P probably damaging Het
Plekha7 C A 7: 115,780,447 (GRCm39) G126W probably damaging Het
Ppp1r13b T C 12: 111,801,353 (GRCm39) K567E probably damaging Het
Pradc1 T A 6: 85,424,548 (GRCm39) Q134L probably benign Het
Pwp2 A G 10: 78,012,170 (GRCm39) F628L probably benign Het
Rab5c C T 11: 100,606,928 (GRCm39) G217D probably benign Het
Rad51ap2 G T 12: 11,506,807 (GRCm39) S243I possibly damaging Het
Rasgrp4 C A 7: 28,847,855 (GRCm39) R432S probably damaging Het
Rhot2 C T 17: 26,061,402 (GRCm39) probably null Het
Scn2a T A 2: 65,594,113 (GRCm39) L1654Q probably damaging Het
Slc22a28 T A 19: 8,094,491 (GRCm39) T177S probably benign Het
Slc25a24 G T 3: 109,065,960 (GRCm39) Q272H probably null Het
Slc3a1 A T 17: 85,339,873 (GRCm39) I144F probably damaging Het
Smg9 C T 7: 24,105,495 (GRCm39) R176C possibly damaging Het
Sorl1 A T 9: 41,948,499 (GRCm39) L762Q probably damaging Het
Srebf2 C A 15: 82,088,270 (GRCm39) P1079T probably benign Het
Sub1 A T 15: 11,993,937 (GRCm39) S4T probably benign Het
Tacr1 A T 6: 82,469,692 (GRCm39) Y192F probably benign Het
Tm4sf19 A T 16: 32,224,814 (GRCm39) H54L probably damaging Het
Tnxb T C 17: 34,914,428 (GRCm39) L1838P probably damaging Het
Trmt1l T C 1: 151,333,539 (GRCm39) S681P possibly damaging Het
Ttn A G 2: 76,738,176 (GRCm39) V4167A unknown Het
Unc13d T A 11: 115,959,056 (GRCm39) M702L probably benign Het
Vgll3 A G 16: 65,636,404 (GRCm39) H240R probably benign Het
Vmn1r189 C G 13: 22,286,737 (GRCm39) W33C probably benign Het
Vmn2r17 G A 5: 109,576,337 (GRCm39) A403T possibly damaging Het
Vmn2r2 G A 3: 64,033,998 (GRCm39) T508I probably benign Het
Vps54 T A 11: 21,227,670 (GRCm39) probably null Het
Wfs1 G A 5: 37,125,134 (GRCm39) Q586* probably null Het
Zbp1 A T 2: 173,055,665 (GRCm39) H166Q unknown Het
Zcchc3 G A 2: 152,256,294 (GRCm39) A135V probably benign Het
Zfp51 T C 17: 21,683,960 (GRCm39) Y192H probably benign Het
Zkscan2 T C 7: 123,088,994 (GRCm39) T426A probably benign Het
Other mutations in Skint6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Skint6 APN 4 112,661,879 (GRCm39) missense possibly damaging 0.96
IGL01296:Skint6 APN 4 113,093,637 (GRCm39) missense probably benign 0.37
IGL01343:Skint6 APN 4 113,140,823 (GRCm39) missense probably benign 0.07
IGL01543:Skint6 APN 4 112,757,160 (GRCm39) missense probably benign 0.18
IGL01633:Skint6 APN 4 113,095,246 (GRCm39) missense probably damaging 1.00
IGL01818:Skint6 APN 4 112,805,766 (GRCm39) missense probably benign 0.18
IGL02124:Skint6 APN 4 112,944,993 (GRCm39) missense probably benign
IGL02517:Skint6 APN 4 112,805,737 (GRCm39) splice site probably benign
IGL02647:Skint6 APN 4 112,985,088 (GRCm39) splice site probably benign
IGL02887:Skint6 APN 4 113,095,381 (GRCm39) nonsense probably null
IGL03026:Skint6 APN 4 112,848,441 (GRCm39) splice site probably null
IGL03030:Skint6 APN 4 112,870,153 (GRCm39) missense probably benign 0.03
meissner UTSW 4 112,661,891 (GRCm39) missense possibly damaging 0.86
Tegmentum UTSW 4 112,700,019 (GRCm39) splice site probably null
PIT4576001:Skint6 UTSW 4 112,910,564 (GRCm39) missense possibly damaging 0.91
R0058:Skint6 UTSW 4 112,904,012 (GRCm39) splice site probably benign
R0058:Skint6 UTSW 4 112,904,012 (GRCm39) splice site probably benign
R0099:Skint6 UTSW 4 112,668,698 (GRCm39) missense possibly damaging 0.53
R0158:Skint6 UTSW 4 113,042,011 (GRCm39) splice site probably benign
R0164:Skint6 UTSW 4 112,848,433 (GRCm39) splice site probably benign
R0312:Skint6 UTSW 4 112,666,297 (GRCm39) missense possibly damaging 0.86
R0591:Skint6 UTSW 4 112,715,366 (GRCm39) splice site probably benign
R0762:Skint6 UTSW 4 112,722,848 (GRCm39) splice site probably benign
R0941:Skint6 UTSW 4 113,095,555 (GRCm39) missense probably damaging 1.00
R1023:Skint6 UTSW 4 113,095,300 (GRCm39) missense probably benign 0.20
R1132:Skint6 UTSW 4 112,755,296 (GRCm39) critical splice donor site probably null
R1228:Skint6 UTSW 4 112,711,649 (GRCm39) missense probably benign
R1338:Skint6 UTSW 4 112,870,158 (GRCm39) missense possibly damaging 0.53
R1432:Skint6 UTSW 4 112,726,721 (GRCm39) splice site probably benign
R1512:Skint6 UTSW 4 113,095,329 (GRCm39) missense probably damaging 1.00
R1577:Skint6 UTSW 4 113,005,720 (GRCm39) missense possibly damaging 0.53
R1733:Skint6 UTSW 4 113,034,234 (GRCm39) splice site probably benign
R1762:Skint6 UTSW 4 113,093,678 (GRCm39) missense probably damaging 0.98
R1891:Skint6 UTSW 4 112,703,893 (GRCm39) missense possibly damaging 0.85
R1908:Skint6 UTSW 4 112,749,187 (GRCm39) missense probably benign
R2069:Skint6 UTSW 4 113,095,329 (GRCm39) missense probably damaging 1.00
R2089:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2091:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2091:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2144:Skint6 UTSW 4 113,093,457 (GRCm39) missense possibly damaging 0.84
R2166:Skint6 UTSW 4 112,711,649 (GRCm39) missense probably benign 0.01
R2192:Skint6 UTSW 4 112,722,909 (GRCm39) nonsense probably null
R2267:Skint6 UTSW 4 112,700,019 (GRCm39) splice site probably null
R2312:Skint6 UTSW 4 113,095,339 (GRCm39) missense probably damaging 1.00
R2324:Skint6 UTSW 4 112,729,654 (GRCm39) splice site probably null
R2342:Skint6 UTSW 4 113,034,180 (GRCm39) missense probably benign 0.00
R3028:Skint6 UTSW 4 113,093,690 (GRCm39) missense possibly damaging 0.92
R3704:Skint6 UTSW 4 112,993,669 (GRCm39) missense possibly damaging 0.86
R3752:Skint6 UTSW 4 112,700,096 (GRCm39) splice site probably benign
R3760:Skint6 UTSW 4 112,794,655 (GRCm39) missense possibly damaging 0.53
R3827:Skint6 UTSW 4 112,794,634 (GRCm39) missense probably benign
R4377:Skint6 UTSW 4 113,093,715 (GRCm39) missense possibly damaging 0.90
R4406:Skint6 UTSW 4 113,013,683 (GRCm39) missense probably benign 0.01
R4611:Skint6 UTSW 4 112,931,273 (GRCm39) missense probably benign
R4780:Skint6 UTSW 4 113,093,594 (GRCm39) missense probably damaging 0.98
R4788:Skint6 UTSW 4 113,095,533 (GRCm39) missense possibly damaging 0.54
R4818:Skint6 UTSW 4 112,812,589 (GRCm39) intron probably benign
R4900:Skint6 UTSW 4 112,924,667 (GRCm39) missense probably benign 0.03
R4972:Skint6 UTSW 4 112,692,265 (GRCm39) missense probably benign
R5008:Skint6 UTSW 4 112,848,452 (GRCm39) missense possibly damaging 0.86
R5016:Skint6 UTSW 4 113,028,730 (GRCm39) critical splice acceptor site probably null
R5085:Skint6 UTSW 4 113,093,465 (GRCm39) missense probably damaging 0.99
R5165:Skint6 UTSW 4 112,722,865 (GRCm39) missense possibly damaging 0.86
R5221:Skint6 UTSW 4 112,752,121 (GRCm39) splice site probably null
R5310:Skint6 UTSW 4 113,041,965 (GRCm39) nonsense probably null
R5423:Skint6 UTSW 4 112,707,937 (GRCm39) missense possibly damaging 0.93
R5436:Skint6 UTSW 4 112,953,788 (GRCm39) missense probably benign 0.08
R5447:Skint6 UTSW 4 112,963,106 (GRCm39) missense probably benign 0.34
R5564:Skint6 UTSW 4 112,846,162 (GRCm39) missense possibly damaging 0.72
R5629:Skint6 UTSW 4 112,870,176 (GRCm39) missense possibly damaging 0.86
R5936:Skint6 UTSW 4 112,953,790 (GRCm39) missense probably benign 0.33
R5993:Skint6 UTSW 4 112,666,276 (GRCm39) missense probably benign 0.02
R6027:Skint6 UTSW 4 112,953,761 (GRCm39) splice site probably null
R6174:Skint6 UTSW 4 112,696,510 (GRCm39) missense possibly damaging 0.53
R6497:Skint6 UTSW 4 113,093,595 (GRCm39) missense probably damaging 0.98
R6552:Skint6 UTSW 4 112,924,687 (GRCm39) missense possibly damaging 0.86
R6645:Skint6 UTSW 4 112,749,235 (GRCm39) missense possibly damaging 0.53
R6810:Skint6 UTSW 4 112,805,577 (GRCm39) splice site probably null
R7003:Skint6 UTSW 4 112,963,109 (GRCm39) missense probably benign 0.01
R7211:Skint6 UTSW 4 113,095,566 (GRCm39) missense probably benign 0.09
R7398:Skint6 UTSW 4 112,755,335 (GRCm39) missense probably benign 0.00
R7438:Skint6 UTSW 4 113,095,425 (GRCm39) missense probably damaging 1.00
R7461:Skint6 UTSW 4 113,034,243 (GRCm39) splice site probably null
R7536:Skint6 UTSW 4 112,668,744 (GRCm39) critical splice acceptor site probably null
R7613:Skint6 UTSW 4 113,034,243 (GRCm39) splice site probably null
R7956:Skint6 UTSW 4 112,703,894 (GRCm39) missense possibly damaging 0.85
R8118:Skint6 UTSW 4 113,013,691 (GRCm39) missense possibly damaging 0.73
R8118:Skint6 UTSW 4 112,722,872 (GRCm39) missense possibly damaging 0.53
R8197:Skint6 UTSW 4 112,752,040 (GRCm39) splice site probably null
R8218:Skint6 UTSW 4 112,696,471 (GRCm39) splice site probably null
R8344:Skint6 UTSW 4 113,093,642 (GRCm39) missense probably damaging 1.00
R8518:Skint6 UTSW 4 113,095,465 (GRCm39) missense possibly damaging 0.58
R8776:Skint6 UTSW 4 112,661,885 (GRCm39) missense possibly damaging 0.96
R8776-TAIL:Skint6 UTSW 4 112,661,885 (GRCm39) missense possibly damaging 0.96
R8794:Skint6 UTSW 4 113,049,869 (GRCm39) missense possibly damaging 0.73
R8796:Skint6 UTSW 4 112,661,891 (GRCm39) missense possibly damaging 0.86
R8812:Skint6 UTSW 4 112,846,149 (GRCm39) missense probably benign 0.00
R8866:Skint6 UTSW 4 112,711,650 (GRCm39) missense probably benign
R8881:Skint6 UTSW 4 112,672,716 (GRCm39) missense possibly damaging 0.53
R8949:Skint6 UTSW 4 112,931,296 (GRCm39) missense probably benign 0.04
R8967:Skint6 UTSW 4 112,729,701 (GRCm39) nonsense probably null
R9005:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9007:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9053:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9055:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9144:Skint6 UTSW 4 112,985,102 (GRCm39) missense possibly damaging 0.73
R9149:Skint6 UTSW 4 113,034,173 (GRCm39) missense probably damaging 0.98
R9297:Skint6 UTSW 4 112,668,717 (GRCm39) missense probably benign 0.00
R9388:Skint6 UTSW 4 113,049,838 (GRCm39) missense possibly damaging 0.85
R9407:Skint6 UTSW 4 113,034,224 (GRCm39) missense possibly damaging 0.53
R9475:Skint6 UTSW 4 112,664,037 (GRCm39) critical splice donor site probably null
R9515:Skint6 UTSW 4 112,715,375 (GRCm39) missense probably benign
R9572:Skint6 UTSW 4 112,985,128 (GRCm39) missense probably benign
R9689:Skint6 UTSW 4 113,093,546 (GRCm39) missense probably damaging 0.99
R9744:Skint6 UTSW 4 112,666,360 (GRCm39) missense probably damaging 1.00
R9785:Skint6 UTSW 4 112,740,884 (GRCm39) missense possibly damaging 0.86
Z1176:Skint6 UTSW 4 113,095,491 (GRCm39) missense probably damaging 0.96
Z1176:Skint6 UTSW 4 112,749,211 (GRCm39) missense possibly damaging 0.53
Z1176:Skint6 UTSW 4 113,095,492 (GRCm39) missense possibly damaging 0.83
Z1177:Skint6 UTSW 4 112,963,158 (GRCm39) critical splice acceptor site probably null
Z1177:Skint6 UTSW 4 112,664,125 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCTGAGAGTAGGGAAATATTAGCAG -3'
(R):5'- TTAGGAACACAATTGGGAGCAAG -3'

Sequencing Primer
(F):5'- AGCAGCTGGATACTTTCACTAGTGC -3'
(R):5'- AGGTACAGCAGGACATTTCC -3'
Posted On 2019-09-23