Incidental Mutation 'R7162:Rorc'
ID574631
Institutional Source Beutler Lab
Gene Symbol Rorc
Ensembl Gene ENSMUSG00000028150
Gene NameRAR-related orphan receptor gamma
SynonymsThor, thymus orphan receptor, RORgamma
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.794) question?
Stock #R7162 (G1)
Quality Score154.008
Status Validated
Chromosome3
Chromosomal Location94372794-94398276 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 94377608 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029795] [ENSMUST00000197040] [ENSMUST00000200009]
Predicted Effect probably benign
Transcript: ENSMUST00000029795
SMART Domains Protein: ENSMUSP00000029795
Gene: ENSMUSG00000028150

DomainStartEndE-ValueType
ZnF_C4 28 99 7.2e-37 SMART
low complexity region 116 133 N/A INTRINSIC
HOLI 320 474 3.78e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000197040
SMART Domains Protein: ENSMUSP00000143763
Gene: ENSMUSG00000028150

DomainStartEndE-ValueType
ZnF_C4 7 78 7.2e-37 SMART
low complexity region 95 112 N/A INTRINSIC
HOLI 299 453 3.78e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000200009
SMART Domains Protein: ENSMUSP00000143610
Gene: ENSMUSG00000028150

DomainStartEndE-ValueType
ZnF_C4 13 84 7.2e-37 SMART
low complexity region 101 118 N/A INTRINSIC
PDB:3L0L|B 243 309 1e-22 PDB
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (85/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA-binding transcription factor and is a member of the NR1 subfamily of nuclear hormone receptors. The specific functions of this protein are not known; however, studies of a similar gene in mice have shown that this gene may be essential for lymphoid organogenesis and may play an important regulatory role in thymopoiesis. In addition, studies in mice suggest that the protein encoded by this gene may inhibit the expression of Fas ligand and IL2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit lack of peripheral and mesenteric lymph nodes and Peyer's patches, reduced numbers of thymocytes, and increased apoptosis with loss of thymic expression of anti-apoptosic factor Bcl-xL. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akp3 C T 1: 87,127,749 T506I unknown Het
Ank1 T C 8: 23,132,354 W1640R possibly damaging Het
Atp2a2 A G 5: 122,489,324 M126T probably benign Het
Bptf A T 11: 107,043,631 probably null Het
Brat1 T C 5: 140,710,249 V125A probably benign Het
Cables1 T C 18: 11,926,366 probably null Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Cacna1b A C 2: 24,700,022 I558S probably benign Het
Ccdc166 A G 15: 75,981,195 S308P probably benign Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Cfhr2 A G 1: 139,813,526 V237A probably benign Het
Clybl C A 14: 122,371,320 S108* probably null Het
Cubn A G 2: 13,342,498 Y2070H probably damaging Het
Cyp8b1 A G 9: 121,915,711 F185S probably damaging Het
Dennd2c T A 3: 103,156,107 V620D probably damaging Het
Dis3l2 T C 1: 87,044,030 F597L possibly damaging Het
Eif3f G A 7: 108,940,731 R282H probably benign Het
Ell C A 8: 70,578,909 R86S possibly damaging Het
Eppk1 A G 15: 76,106,609 V2024A possibly damaging Het
Exoc6 T C 19: 37,577,118 I214T probably damaging Het
Faim2 A G 15: 99,521,167 probably null Het
Gli1 A G 10: 127,332,437 S516P probably benign Het
Gm18596 A T 10: 77,742,200 S147T unknown Het
Gm19965 A G 1: 116,822,365 Y592C unknown Het
Gng12 T C 6: 67,017,301 S36P unknown Het
Gramd3 G A 18: 56,485,457 probably null Het
Hmcn1 T A 1: 150,748,993 T1054S probably benign Het
Ifngr1 A G 10: 19,609,353 T367A probably benign Het
Il21r G T 7: 125,632,311 V304L probably benign Het
Ino80d G A 1: 63,065,735 T394M probably damaging Het
Itfg2 C T 6: 128,410,583 V380M probably damaging Het
Kcna5 C T 6: 126,533,843 V441I possibly damaging Het
Kcp T A 6: 29,497,200 probably null Het
Kdf1 C T 4: 133,529,918 T375I unknown Het
Klk1b1 A T 7: 43,969,247 D16V probably damaging Het
Krtap5-4 A C 7: 142,303,598 T2P unknown Het
Lamtor1 A G 7: 101,906,036 D13G probably benign Het
Lrp10 T C 14: 54,465,706 V72A possibly damaging Het
Lrrc1 C A 9: 77,432,190 A503S probably benign Het
Mylk A T 16: 34,922,529 D1137V probably damaging Het
Myo5b C G 18: 74,695,427 L717V probably benign Het
Myoz3 T A 18: 60,576,413 R225S probably damaging Het
Myrf A G 19: 10,218,646 F335L possibly damaging Het
Nfib A C 4: 82,350,440 S292A probably damaging Het
Notch3 G T 17: 32,146,449 H1096Q probably damaging Het
Nt5c1a A G 4: 123,214,105 R194G probably benign Het
Olfr76 A G 19: 12,120,137 F192L possibly damaging Het
Olfr958 A G 9: 39,550,229 I214T probably damaging Het
Parp4 A G 14: 56,648,876 E1804G unknown Het
Pcdhac2 A T 18: 37,145,787 I607L probably benign Het
Pcdhb5 A G 18: 37,321,686 D373G probably benign Het
Pcf11 A T 7: 92,664,013 V154E probably damaging Het
Pdia3 T G 2: 121,429,521 D180E probably benign Het
Piezo2 C A 18: 63,124,709 V313F possibly damaging Het
Pik3ap1 C A 19: 41,321,526 A452S probably benign Het
Plb1 A G 5: 32,349,663 K1194R probably benign Het
Pld3 A C 7: 27,532,474 W431G probably damaging Het
Plekha3 T C 2: 76,692,766 probably null Het
Ppm1f G T 16: 16,914,193 R169L probably damaging Het
Ppp2r3d A G 9: 124,439,673 V60A Het
Prop1 T A 11: 50,952,054 D102V probably damaging Het
Rbm27 G A 18: 42,314,027 G446R unknown Het
Rc3h2 C A 2: 37,409,605 V138L possibly damaging Het
Sardh A G 2: 27,197,690 V723A possibly damaging Het
Sart3 A G 5: 113,762,835 Y181H probably damaging Het
Sbpl A T 17: 23,953,465 M160K possibly damaging Het
Sh3gl3 A G 7: 82,284,142 S238G probably benign Het
Slc22a30 A G 19: 8,336,717 probably null Het
Slc3a1 A T 17: 85,064,014 R665* probably null Het
Stk32a C A 18: 43,297,584 Y186* probably null Het
Stxbp6 T C 12: 44,902,880 N89D probably benign Het
Svep1 A G 4: 58,070,262 F2508S possibly damaging Het
Tas1r1 A G 4: 152,032,238 V313A possibly damaging Het
Tmem81 T C 1: 132,507,617 Y54H probably damaging Het
Tmtc1 T C 6: 148,271,487 N582S probably damaging Het
Top2b T C 14: 16,416,653 S1138P probably benign Het
Trim24 T A 6: 37,965,521 N989K possibly damaging Het
Trim72 T A 7: 128,007,649 M145K probably benign Het
Ttll9 T A 2: 152,989,603 S154T probably damaging Het
Tusc3 T C 8: 39,126,587 V286A probably benign Het
Vat1l C A 8: 114,236,778 H185N probably damaging Het
Vmn1r209 A T 13: 22,805,958 D187E probably damaging Het
Vmn2r87 T C 10: 130,477,547 N450S probably benign Het
Wdr7 T A 18: 63,724,139 D95E possibly damaging Het
Zfp937 C T 2: 150,239,519 H490Y probably benign Het
Zfp974 A T 7: 27,911,519 H260Q possibly damaging Het
Other mutations in Rorc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Rorc APN 3 94388787 missense probably damaging 1.00
beto UTSW 3 94377608 splice site probably null
cashew UTSW 3 94391153 missense probably damaging 1.00
chestnut UTSW 3 94377609 splice site probably benign
macadamias UTSW 3 94397302 nonsense probably null
macadamias2 UTSW 3 94387193 missense probably damaging 1.00
R0014:Rorc UTSW 3 94377613 splice site probably benign
R0115:Rorc UTSW 3 94377609 splice site probably benign
R0365:Rorc UTSW 3 94388762 missense probably damaging 1.00
R1470:Rorc UTSW 3 94397302 nonsense probably null
R1470:Rorc UTSW 3 94397302 nonsense probably null
R1914:Rorc UTSW 3 94391173 missense probably damaging 1.00
R1915:Rorc UTSW 3 94391173 missense probably damaging 1.00
R2142:Rorc UTSW 3 94389526 missense probably benign 0.04
R2510:Rorc UTSW 3 94389120 missense probably benign 0.30
R4135:Rorc UTSW 3 94389519 missense probably damaging 1.00
R4181:Rorc UTSW 3 94387193 missense probably damaging 1.00
R4574:Rorc UTSW 3 94388984 missense probably benign 0.00
R4701:Rorc UTSW 3 94391710 missense probably null 1.00
R5014:Rorc UTSW 3 94391153 missense probably damaging 1.00
R5233:Rorc UTSW 3 94397325 missense probably benign 0.26
R6758:Rorc UTSW 3 94387518 missense possibly damaging 0.90
R7069:Rorc UTSW 3 94372907 nonsense probably null
R7169:Rorc UTSW 3 94389180 missense probably benign 0.00
R7730:Rorc UTSW 3 94393114 missense probably benign 0.43
X0063:Rorc UTSW 3 94391751 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGGAGCAGAGCTTAAACCC -3'
(R):5'- TCAGAACTTATGTCAGGAACTCC -3'

Sequencing Primer
(F):5'- CCCCTGCCCAGAAACACTG -3'
(R):5'- GATTACCATTGCTGCCAAGG -3'
Posted On2019-09-25