Incidental Mutation 'R0626:Fsip2'
ID 57464
Institutional Source Beutler Lab
Gene Symbol Fsip2
Ensembl Gene ENSMUSG00000075249
Gene Name fibrous sheath-interacting protein 2
Synonyms OTTMUSG00000013335
MMRRC Submission 038815-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R0626 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 82773978-82839281 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 82819302 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 5012 (I5012V)
Ref Sequence ENSEMBL: ENSMUSP00000120314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143764]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000132967
SMART Domains Protein: ENSMUSP00000122350
Gene: ENSMUSG00000075249

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 381 392 N/A INTRINSIC
low complexity region 411 430 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
low complexity region 953 962 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143764
AA Change: I5012V

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000120314
Gene: ENSMUSG00000075249
AA Change: I5012V

DomainStartEndE-ValueType
coiled coil region 271 297 N/A INTRINSIC
low complexity region 544 561 N/A INTRINSIC
low complexity region 586 597 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1115 1120 N/A INTRINSIC
low complexity region 1531 1545 N/A INTRINSIC
low complexity region 2044 2057 N/A INTRINSIC
low complexity region 2507 2523 N/A INTRINSIC
low complexity region 2564 2575 N/A INTRINSIC
low complexity region 2866 2877 N/A INTRINSIC
low complexity region 2896 2915 N/A INTRINSIC
low complexity region 3220 3231 N/A INTRINSIC
low complexity region 3438 3447 N/A INTRINSIC
Pfam:FSIP2 4045 4408 3.5e-42 PFAM
Pfam:FSIP2 4375 4613 7.7e-26 PFAM
Pfam:FSIP2 4622 4932 4.3e-17 PFAM
Pfam:FSIP2 4903 5454 7e-27 PFAM
low complexity region 5507 5522 N/A INTRINSIC
low complexity region 5769 5780 N/A INTRINSIC
low complexity region 5834 5846 N/A INTRINSIC
low complexity region 5851 5867 N/A INTRINSIC
Pfam:FSIP2 5998 6867 N/A PFAM
low complexity region 6977 6990 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the sperm fibrous sheath. Genes encoding most of the fibrous-sheath associated proteins genes are transcribed only during the postmeiotic period of spermatogenesis. The protein encoded by this gene is specific to spermatogenic cells. Copy number variation in this gene may be associated with testicular germ cell tumors. Pseudogenes associated with this gene are reported on chromosomes 2 and X. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,679,547 (GRCm39) probably benign Het
6430571L13Rik T A 9: 107,219,707 (GRCm39) D53E possibly damaging Het
A2ml1 T A 6: 128,527,736 (GRCm39) N1018I probably damaging Het
Abi3 C A 11: 95,727,937 (GRCm39) A85S probably benign Het
Acsl5 A T 19: 55,272,904 (GRCm39) M340L probably benign Het
Adam29 T A 8: 56,324,612 (GRCm39) H614L probably benign Het
Adgrg6 A T 10: 14,312,628 (GRCm39) S720T probably damaging Het
Adrb2 G T 18: 62,312,441 (GRCm39) A128E probably damaging Het
Afap1l1 T C 18: 61,872,291 (GRCm39) E510G probably benign Het
Angel1 A G 12: 86,764,487 (GRCm39) probably null Het
Aox3 T G 1: 58,211,458 (GRCm39) I1005S possibly damaging Het
Apc C A 18: 34,451,507 (GRCm39) P2767Q probably damaging Het
Apob T G 12: 8,066,193 (GRCm39) D4387E probably benign Het
Apobr T C 7: 126,185,827 (GRCm39) V446A possibly damaging Het
Arhgap28 A T 17: 68,203,108 (GRCm39) probably null Het
Aspm G T 1: 139,419,339 (GRCm39) K3001N probably damaging Het
Asxl3 G T 18: 22,655,937 (GRCm39) V1316F probably benign Het
Atp2a1 T A 7: 126,046,162 (GRCm39) probably null Het
Bach1 A G 16: 87,526,359 (GRCm39) D607G possibly damaging Het
Batf3 A G 1: 190,832,935 (GRCm39) D27G probably damaging Het
Baz1a G T 12: 55,022,055 (GRCm39) Q76K probably damaging Het
Bdnf G A 2: 109,553,883 (GRCm39) V86M probably benign Het
Birc7 A G 2: 180,573,098 (GRCm39) I172V probably benign Het
Bod1l A C 5: 41,988,880 (GRCm39) V409G probably damaging Het
Cacna1e T A 1: 154,364,563 (GRCm39) E337V probably damaging Het
Cacna1h A G 17: 25,612,520 (GRCm39) F287L possibly damaging Het
Ces1e A G 8: 93,950,671 (GRCm39) Y37H probably benign Het
Clasrp A T 7: 19,318,418 (GRCm39) probably benign Het
Clec2d T A 6: 129,160,090 (GRCm39) S35T probably damaging Het
Cntn4 T A 6: 106,639,539 (GRCm39) D556E probably benign Het
Cntnap5c A T 17: 58,349,422 (GRCm39) D245V probably benign Het
Col5a1 T A 2: 27,818,255 (GRCm39) L160* probably null Het
Col6a6 T C 9: 105,654,943 (GRCm39) E926G probably benign Het
Cpsf2 T A 12: 101,951,490 (GRCm39) H142Q probably benign Het
Cr2 A C 1: 194,853,419 (GRCm39) S20A possibly damaging Het
Ct45a G A X: 55,590,399 (GRCm39) P134L probably benign Het
Cyp2j5 A T 4: 96,547,749 (GRCm39) H164Q probably benign Het
D430041D05Rik G C 2: 103,998,295 (GRCm39) P1836R probably damaging Het
Dmbt1 G A 7: 130,703,811 (GRCm39) V1124M probably damaging Het
Dmxl2 T C 9: 54,323,838 (GRCm39) H1182R probably damaging Het
Dnah2 A T 11: 69,368,509 (GRCm39) S1709T probably benign Het
Dop1b T C 16: 93,560,844 (GRCm39) V776A probably damaging Het
Emc3 T C 6: 113,492,992 (GRCm39) T220A probably benign Het
Entpd1 A C 19: 40,715,769 (GRCm39) N312T probably benign Het
Fam8a1 A T 13: 46,824,699 (GRCm39) I229F probably damaging Het
Fancc G A 13: 63,465,205 (GRCm39) P501S probably damaging Het
Fasn T C 11: 120,702,751 (GRCm39) R1704G probably damaging Het
Glce T C 9: 61,968,282 (GRCm39) T290A probably benign Het
Gns G A 10: 121,219,349 (GRCm39) probably null Het
Gsdma2 A G 11: 98,542,810 (GRCm39) N190S probably damaging Het
Hectd4 T A 5: 121,415,887 (GRCm39) S563T probably benign Het
Hmcn1 T C 1: 150,674,470 (GRCm39) probably null Het
Jup A T 11: 100,267,589 (GRCm39) M578K probably benign Het
Kir3dl1 G A X: 135,434,594 (GRCm39) probably null Het
Krt75 A G 15: 101,482,025 (GRCm39) F81S probably benign Het
Lrp1 G T 10: 127,403,233 (GRCm39) D2113E probably damaging Het
Maged2 T A X: 149,594,830 (GRCm39) N176Y probably damaging Het
Mrc1 T A 2: 14,333,382 (GRCm39) C1354* probably null Het
Mup7 A C 4: 60,069,742 (GRCm39) V74G possibly damaging Het
Naca A G 10: 127,877,031 (GRCm39) probably benign Het
Nav3 T G 10: 109,659,325 (GRCm39) Y764S probably damaging Het
Nkpd1 A T 7: 19,257,099 (GRCm39) T293S probably benign Het
Numb A G 12: 83,842,614 (GRCm39) Y510H probably damaging Het
Nynrin T G 14: 56,105,492 (GRCm39) L834R probably damaging Het
Or11g27 T C 14: 50,771,159 (GRCm39) S97P possibly damaging Het
Or2ak5 G T 11: 58,611,347 (GRCm39) H176N probably benign Het
Or8g18 T A 9: 39,149,162 (GRCm39) N186I possibly damaging Het
Otog T C 7: 45,920,797 (GRCm39) V1000A possibly damaging Het
Pafah1b3 A G 7: 24,996,554 (GRCm39) V43A possibly damaging Het
Pcnx1 A G 12: 82,030,450 (GRCm39) Y1775C possibly damaging Het
Phka1 G A X: 101,564,437 (GRCm39) R1074C probably damaging Het
Pi4ka T A 16: 17,111,765 (GRCm39) Y1570F probably benign Het
Piezo2 T C 18: 63,152,329 (GRCm39) K2588E probably damaging Het
Pkd1 A G 17: 24,794,549 (GRCm39) T2079A probably damaging Het
Plekhd1 G T 12: 80,764,075 (GRCm39) Q212H probably damaging Het
Plekhh1 C T 12: 79,087,359 (GRCm39) R16* probably null Het
Polm C A 11: 5,786,207 (GRCm39) R120L probably damaging Het
Ptpn22 T C 3: 103,767,721 (GRCm39) M1T probably null Het
Ptprh G A 7: 4,567,271 (GRCm39) L534F probably benign Het
Rabl6 C T 2: 25,482,778 (GRCm39) probably null Het
Rap2a A G 14: 120,716,403 (GRCm39) S89G probably damaging Het
Rara A T 11: 98,862,406 (GRCm39) probably null Het
Reck A G 4: 43,930,295 (GRCm39) D623G probably benign Het
Relt A T 7: 100,498,023 (GRCm39) L237Q probably damaging Het
Rngtt A G 4: 33,329,598 (GRCm39) probably null Het
Rtn4rl2 T G 2: 84,710,763 (GRCm39) Y167S probably damaging Het
Sec24c C T 14: 20,738,505 (GRCm39) R353C probably damaging Het
Slc35g2 T C 9: 100,435,495 (GRCm39) S59G probably benign Het
Smarcd2 A T 11: 106,158,241 (GRCm39) M107K probably benign Het
Smg1 T C 7: 117,781,606 (GRCm39) N1227S possibly damaging Het
Snrnp200 A G 2: 127,063,734 (GRCm39) N638D possibly damaging Het
Sntb1 A G 15: 55,506,179 (GRCm39) S465P probably benign Het
Sp4 A G 12: 118,263,314 (GRCm39) L244P probably damaging Het
Sulf1 A G 1: 12,887,716 (GRCm39) probably null Het
Tbc1d17 T C 7: 44,492,509 (GRCm39) T385A probably benign Het
Tbx10 C A 19: 4,047,873 (GRCm39) D206E probably benign Het
Tcea2 C T 2: 181,329,431 (GRCm39) P275S probably damaging Het
Tns3 C A 11: 8,443,121 (GRCm39) R414L probably benign Het
Trip11 T C 12: 101,852,235 (GRCm39) R610G possibly damaging Het
Ugt2b1 T C 5: 87,073,720 (GRCm39) K213R probably null Het
Unc80 A G 1: 66,647,601 (GRCm39) S1514G probably benign Het
Usp7 G T 16: 8,511,778 (GRCm39) Q867K possibly damaging Het
Vim T C 2: 13,579,463 (GRCm39) V74A probably benign Het
Vmn1r234 A G 17: 21,450,007 (GRCm39) Y307C probably benign Het
Vmn2r74 A T 7: 85,610,517 (GRCm39) Y58* probably null Het
Wdr36 C A 18: 32,983,584 (GRCm39) A445E probably damaging Het
Xpo5 T A 17: 46,532,359 (GRCm39) W465R probably damaging Het
Zscan4d T A 7: 10,898,946 (GRCm39) R110S probably damaging Het
Other mutations in Fsip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Fsip2 APN 2 82,820,730 (GRCm39) missense probably benign 0.18
IGL00557:Fsip2 APN 2 82,821,657 (GRCm39) missense possibly damaging 0.53
IGL01343:Fsip2 APN 2 82,830,163 (GRCm39) missense possibly damaging 0.53
IGL01387:Fsip2 APN 2 82,823,326 (GRCm39) missense possibly damaging 0.71
IGL01523:Fsip2 APN 2 82,807,863 (GRCm39) missense probably benign
IGL01554:Fsip2 APN 2 82,807,622 (GRCm39) missense possibly damaging 0.68
IGL01650:Fsip2 APN 2 82,821,430 (GRCm39) missense probably benign 0.33
IGL01809:Fsip2 APN 2 82,808,691 (GRCm39) missense possibly damaging 0.80
IGL01826:Fsip2 APN 2 82,812,983 (GRCm39) missense probably benign 0.18
IGL01830:Fsip2 APN 2 82,815,273 (GRCm39) missense probably benign
IGL01918:Fsip2 APN 2 82,822,482 (GRCm39) missense possibly damaging 0.71
IGL01932:Fsip2 APN 2 82,824,349 (GRCm39) missense possibly damaging 0.71
IGL01989:Fsip2 APN 2 82,824,211 (GRCm39) missense probably damaging 0.99
IGL02096:Fsip2 APN 2 82,822,204 (GRCm39) missense possibly damaging 0.85
IGL02153:Fsip2 APN 2 82,809,065 (GRCm39) missense probably benign
IGL02155:Fsip2 APN 2 82,828,696 (GRCm39) missense probably benign
IGL02219:Fsip2 APN 2 82,808,174 (GRCm39) missense probably benign 0.07
IGL02248:Fsip2 APN 2 82,813,116 (GRCm39) missense possibly damaging 0.73
IGL02316:Fsip2 APN 2 82,809,137 (GRCm39) missense probably benign
IGL02478:Fsip2 APN 2 82,814,736 (GRCm39) missense probably benign 0.00
IGL02504:Fsip2 APN 2 82,809,199 (GRCm39) missense possibly damaging 0.83
IGL02572:Fsip2 APN 2 82,822,347 (GRCm39) missense probably benign 0.32
IGL02625:Fsip2 APN 2 82,779,836 (GRCm39) missense probably benign 0.00
IGL02665:Fsip2 APN 2 82,823,407 (GRCm39) missense probably damaging 1.00
IGL02668:Fsip2 APN 2 82,828,662 (GRCm39) missense probably benign 0.06
IGL02676:Fsip2 APN 2 82,812,501 (GRCm39) missense possibly damaging 0.53
IGL02717:Fsip2 APN 2 82,781,370 (GRCm39) splice site probably benign
IGL02805:Fsip2 APN 2 82,823,839 (GRCm39) missense probably benign 0.01
IGL02943:Fsip2 APN 2 82,822,701 (GRCm39) missense probably benign 0.32
IGL02965:Fsip2 APN 2 82,813,398 (GRCm39) missense probably benign 0.33
IGL03001:Fsip2 APN 2 82,820,968 (GRCm39) intron probably benign
IGL03076:Fsip2 APN 2 82,812,482 (GRCm39) missense possibly damaging 0.96
IGL03229:Fsip2 APN 2 82,808,420 (GRCm39) missense possibly damaging 0.86
IGL03353:Fsip2 APN 2 82,807,737 (GRCm39) missense possibly damaging 0.85
IGL03401:Fsip2 APN 2 82,820,814 (GRCm39) missense probably benign
bubblegum UTSW 2 82,823,184 (GRCm39) missense probably benign 0.16
Dao UTSW 2 82,823,494 (GRCm39) missense probably damaging 0.97
engulf UTSW 2 82,815,120 (GRCm39) missense probably damaging 0.98
envelope UTSW 2 82,811,085 (GRCm39) missense probably benign 0.07
gladius UTSW 2 82,812,293 (GRCm39) missense possibly damaging 0.68
glove UTSW 2 82,808,738 (GRCm39) missense possibly damaging 0.85
Katana UTSW 2 82,819,860 (GRCm39) missense probably benign 0.07
scarf UTSW 2 82,817,235 (GRCm39) missense probably benign
Sock UTSW 2 82,828,524 (GRCm39) missense probably benign 0.00
swaddle UTSW 2 82,813,772 (GRCm39) missense possibly damaging 0.93
wrap UTSW 2 82,817,164 (GRCm39) missense probably benign 0.04
Wrapper UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
D4186:Fsip2 UTSW 2 82,818,756 (GRCm39) missense probably benign 0.32
FR4976:Fsip2 UTSW 2 82,814,709 (GRCm39) critical splice acceptor site probably benign
FR4976:Fsip2 UTSW 2 82,814,706 (GRCm39) critical splice acceptor site probably benign
PIT4382001:Fsip2 UTSW 2 82,821,196 (GRCm39) missense possibly damaging 0.86
R0017:Fsip2 UTSW 2 82,822,416 (GRCm39) missense probably damaging 0.98
R0017:Fsip2 UTSW 2 82,822,416 (GRCm39) missense probably damaging 0.98
R0021:Fsip2 UTSW 2 82,830,201 (GRCm39) splice site probably benign
R0054:Fsip2 UTSW 2 82,817,299 (GRCm39) missense possibly damaging 0.85
R0054:Fsip2 UTSW 2 82,817,299 (GRCm39) missense possibly damaging 0.85
R0054:Fsip2 UTSW 2 82,806,952 (GRCm39) missense probably damaging 0.96
R0104:Fsip2 UTSW 2 82,809,317 (GRCm39) missense possibly damaging 0.91
R0104:Fsip2 UTSW 2 82,809,317 (GRCm39) missense possibly damaging 0.91
R0127:Fsip2 UTSW 2 82,815,269 (GRCm39) missense probably benign 0.28
R0131:Fsip2 UTSW 2 82,821,465 (GRCm39) missense probably benign
R0149:Fsip2 UTSW 2 82,805,849 (GRCm39) missense possibly damaging 0.93
R0167:Fsip2 UTSW 2 82,811,151 (GRCm39) missense possibly damaging 0.53
R0190:Fsip2 UTSW 2 82,815,521 (GRCm39) missense possibly damaging 0.73
R0323:Fsip2 UTSW 2 82,816,240 (GRCm39) missense probably benign 0.33
R0358:Fsip2 UTSW 2 82,813,677 (GRCm39) missense possibly damaging 0.56
R0361:Fsip2 UTSW 2 82,805,849 (GRCm39) missense possibly damaging 0.93
R0369:Fsip2 UTSW 2 82,814,908 (GRCm39) missense probably benign 0.33
R0394:Fsip2 UTSW 2 82,821,419 (GRCm39) missense possibly damaging 0.70
R0532:Fsip2 UTSW 2 82,808,129 (GRCm39) missense probably benign 0.33
R0595:Fsip2 UTSW 2 82,777,296 (GRCm39) missense probably damaging 0.99
R0613:Fsip2 UTSW 2 82,824,139 (GRCm39) missense probably damaging 0.99
R0614:Fsip2 UTSW 2 82,807,877 (GRCm39) missense probably benign 0.15
R0619:Fsip2 UTSW 2 82,774,484 (GRCm39) missense probably damaging 1.00
R0644:Fsip2 UTSW 2 82,807,241 (GRCm39) missense probably benign 0.02
R0661:Fsip2 UTSW 2 82,816,513 (GRCm39) missense possibly damaging 0.92
R0680:Fsip2 UTSW 2 82,821,703 (GRCm39) missense possibly damaging 0.73
R0688:Fsip2 UTSW 2 82,812,683 (GRCm39) missense probably benign 0.18
R0881:Fsip2 UTSW 2 82,816,617 (GRCm39) missense possibly damaging 0.52
R0919:Fsip2 UTSW 2 82,815,828 (GRCm39) missense possibly damaging 0.53
R0973:Fsip2 UTSW 2 82,807,436 (GRCm39) missense probably benign 0.05
R0973:Fsip2 UTSW 2 82,807,436 (GRCm39) missense probably benign 0.05
R0974:Fsip2 UTSW 2 82,807,436 (GRCm39) missense probably benign 0.05
R0976:Fsip2 UTSW 2 82,828,375 (GRCm39) missense possibly damaging 0.92
R1025:Fsip2 UTSW 2 82,819,780 (GRCm39) nonsense probably null
R1026:Fsip2 UTSW 2 82,818,805 (GRCm39) missense possibly damaging 0.52
R1140:Fsip2 UTSW 2 82,805,378 (GRCm39) missense probably damaging 0.99
R1170:Fsip2 UTSW 2 82,821,844 (GRCm39) missense possibly damaging 0.72
R1180:Fsip2 UTSW 2 82,805,570 (GRCm39) missense probably damaging 0.99
R1188:Fsip2 UTSW 2 82,805,361 (GRCm39) missense possibly damaging 0.96
R1226:Fsip2 UTSW 2 82,811,355 (GRCm39) missense probably damaging 0.96
R1248:Fsip2 UTSW 2 82,820,107 (GRCm39) missense possibly damaging 0.93
R1273:Fsip2 UTSW 2 82,819,752 (GRCm39) missense possibly damaging 0.92
R1323:Fsip2 UTSW 2 82,816,096 (GRCm39) missense probably damaging 1.00
R1323:Fsip2 UTSW 2 82,816,096 (GRCm39) missense probably damaging 1.00
R1356:Fsip2 UTSW 2 82,820,089 (GRCm39) missense probably benign 0.38
R1413:Fsip2 UTSW 2 82,818,762 (GRCm39) missense possibly damaging 0.93
R1430:Fsip2 UTSW 2 82,828,407 (GRCm39) missense possibly damaging 0.71
R1475:Fsip2 UTSW 2 82,817,539 (GRCm39) missense probably damaging 0.99
R1489:Fsip2 UTSW 2 82,810,155 (GRCm39) missense probably benign
R1520:Fsip2 UTSW 2 82,811,058 (GRCm39) missense possibly damaging 0.96
R1543:Fsip2 UTSW 2 82,811,931 (GRCm39) missense possibly damaging 0.91
R1581:Fsip2 UTSW 2 82,816,626 (GRCm39) missense probably damaging 0.98
R1590:Fsip2 UTSW 2 82,813,131 (GRCm39) missense probably benign 0.26
R1646:Fsip2 UTSW 2 82,808,861 (GRCm39) missense probably benign 0.07
R1678:Fsip2 UTSW 2 82,816,689 (GRCm39) missense probably benign
R1700:Fsip2 UTSW 2 82,822,081 (GRCm39) missense probably benign 0.33
R1717:Fsip2 UTSW 2 82,805,289 (GRCm39) missense possibly damaging 0.68
R1741:Fsip2 UTSW 2 82,820,256 (GRCm39) missense probably benign 0.32
R1760:Fsip2 UTSW 2 82,818,055 (GRCm39) missense possibly damaging 0.71
R1760:Fsip2 UTSW 2 82,815,240 (GRCm39) missense probably benign 0.07
R1760:Fsip2 UTSW 2 82,830,185 (GRCm39) missense possibly damaging 0.85
R1789:Fsip2 UTSW 2 82,807,906 (GRCm39) missense probably benign 0.00
R1850:Fsip2 UTSW 2 82,814,933 (GRCm39) missense possibly damaging 0.72
R1854:Fsip2 UTSW 2 82,823,601 (GRCm39) missense possibly damaging 0.84
R1888:Fsip2 UTSW 2 82,774,504 (GRCm39) missense probably benign 0.04
R1888:Fsip2 UTSW 2 82,774,504 (GRCm39) missense probably benign 0.04
R1905:Fsip2 UTSW 2 82,813,772 (GRCm39) missense possibly damaging 0.93
R1907:Fsip2 UTSW 2 82,813,772 (GRCm39) missense possibly damaging 0.93
R1920:Fsip2 UTSW 2 82,817,164 (GRCm39) missense probably benign 0.04
R1921:Fsip2 UTSW 2 82,811,127 (GRCm39) nonsense probably null
R1921:Fsip2 UTSW 2 82,817,164 (GRCm39) missense probably benign 0.04
R1931:Fsip2 UTSW 2 82,817,077 (GRCm39) missense probably damaging 0.99
R1934:Fsip2 UTSW 2 82,810,902 (GRCm39) missense possibly damaging 0.91
R1959:Fsip2 UTSW 2 82,821,894 (GRCm39) missense probably benign
R1965:Fsip2 UTSW 2 82,823,124 (GRCm39) missense possibly damaging 0.86
R1966:Fsip2 UTSW 2 82,823,124 (GRCm39) missense possibly damaging 0.86
R1983:Fsip2 UTSW 2 82,810,175 (GRCm39) missense probably benign
R1988:Fsip2 UTSW 2 82,806,861 (GRCm39) missense possibly damaging 0.56
R2016:Fsip2 UTSW 2 82,813,076 (GRCm39) missense possibly damaging 0.53
R2017:Fsip2 UTSW 2 82,813,076 (GRCm39) missense possibly damaging 0.53
R2026:Fsip2 UTSW 2 82,819,788 (GRCm39) missense possibly damaging 0.71
R2034:Fsip2 UTSW 2 82,819,838 (GRCm39) missense probably benign 0.43
R2037:Fsip2 UTSW 2 82,808,856 (GRCm39) missense probably damaging 0.99
R2070:Fsip2 UTSW 2 82,806,699 (GRCm39) missense probably damaging 0.98
R2072:Fsip2 UTSW 2 82,839,159 (GRCm39) missense possibly damaging 0.53
R2075:Fsip2 UTSW 2 82,818,923 (GRCm39) missense possibly damaging 0.85
R2143:Fsip2 UTSW 2 82,820,615 (GRCm39) missense possibly damaging 0.93
R2207:Fsip2 UTSW 2 82,807,823 (GRCm39) missense probably benign 0.02
R2256:Fsip2 UTSW 2 82,793,095 (GRCm39) missense probably benign 0.07
R2315:Fsip2 UTSW 2 82,805,437 (GRCm39) missense probably benign
R2344:Fsip2 UTSW 2 82,820,257 (GRCm39) missense possibly damaging 0.71
R2377:Fsip2 UTSW 2 82,806,593 (GRCm39) missense probably benign 0.29
R2403:Fsip2 UTSW 2 82,811,064 (GRCm39) missense possibly damaging 0.53
R2441:Fsip2 UTSW 2 82,815,685 (GRCm39) missense possibly damaging 0.53
R2504:Fsip2 UTSW 2 82,809,954 (GRCm39) missense possibly damaging 0.86
R2510:Fsip2 UTSW 2 82,816,782 (GRCm39) missense probably benign
R2511:Fsip2 UTSW 2 82,816,782 (GRCm39) missense probably benign
R2511:Fsip2 UTSW 2 82,782,001 (GRCm39) missense probably damaging 1.00
R2512:Fsip2 UTSW 2 82,808,511 (GRCm39) missense probably benign 0.04
R2568:Fsip2 UTSW 2 82,820,775 (GRCm39) missense probably benign 0.14
R2656:Fsip2 UTSW 2 82,809,389 (GRCm39) missense possibly damaging 0.83
R2883:Fsip2 UTSW 2 82,821,868 (GRCm39) missense possibly damaging 0.86
R3417:Fsip2 UTSW 2 82,816,854 (GRCm39) missense possibly damaging 0.51
R3431:Fsip2 UTSW 2 82,822,354 (GRCm39) missense possibly damaging 0.85
R3441:Fsip2 UTSW 2 82,817,071 (GRCm39) missense probably benign 0.00
R3605:Fsip2 UTSW 2 82,815,253 (GRCm39) missense probably benign 0.28
R3620:Fsip2 UTSW 2 82,810,602 (GRCm39) missense probably benign 0.00
R3621:Fsip2 UTSW 2 82,810,602 (GRCm39) missense probably benign 0.00
R3726:Fsip2 UTSW 2 82,819,311 (GRCm39) missense possibly damaging 0.84
R3755:Fsip2 UTSW 2 82,808,561 (GRCm39) missense probably benign 0.26
R3789:Fsip2 UTSW 2 82,813,058 (GRCm39) missense probably damaging 0.96
R3836:Fsip2 UTSW 2 82,781,290 (GRCm39) missense probably damaging 1.00
R3844:Fsip2 UTSW 2 82,819,950 (GRCm39) missense possibly damaging 0.52
R3846:Fsip2 UTSW 2 82,816,759 (GRCm39) missense possibly damaging 0.52
R3861:Fsip2 UTSW 2 82,815,120 (GRCm39) missense probably damaging 0.98
R3981:Fsip2 UTSW 2 82,789,006 (GRCm39) missense probably benign 0.08
R4014:Fsip2 UTSW 2 82,813,862 (GRCm39) missense probably benign
R4042:Fsip2 UTSW 2 82,813,896 (GRCm39) missense probably benign 0.02
R4075:Fsip2 UTSW 2 82,813,245 (GRCm39) missense probably benign 0.26
R4154:Fsip2 UTSW 2 82,817,413 (GRCm39) missense possibly damaging 0.71
R4210:Fsip2 UTSW 2 82,805,493 (GRCm39) missense probably damaging 0.99
R4211:Fsip2 UTSW 2 82,805,493 (GRCm39) missense probably damaging 0.99
R4327:Fsip2 UTSW 2 82,817,403 (GRCm39) missense probably benign 0.25
R4332:Fsip2 UTSW 2 82,808,201 (GRCm39) missense probably benign 0.00
R4440:Fsip2 UTSW 2 82,821,550 (GRCm39) missense possibly damaging 0.85
R4454:Fsip2 UTSW 2 82,821,120 (GRCm39) missense possibly damaging 0.70
R4455:Fsip2 UTSW 2 82,821,120 (GRCm39) missense possibly damaging 0.70
R4457:Fsip2 UTSW 2 82,821,120 (GRCm39) missense possibly damaging 0.70
R4458:Fsip2 UTSW 2 82,821,120 (GRCm39) missense possibly damaging 0.70
R4540:Fsip2 UTSW 2 82,782,009 (GRCm39) missense probably benign
R4549:Fsip2 UTSW 2 82,819,972 (GRCm39) missense probably damaging 0.99
R4558:Fsip2 UTSW 2 82,815,297 (GRCm39) missense possibly damaging 0.73
R4573:Fsip2 UTSW 2 82,816,510 (GRCm39) missense possibly damaging 0.71
R4583:Fsip2 UTSW 2 82,809,017 (GRCm39) missense probably benign 0.33
R4618:Fsip2 UTSW 2 82,818,103 (GRCm39) missense probably benign
R4700:Fsip2 UTSW 2 82,817,373 (GRCm39) missense probably benign 0.32
R4716:Fsip2 UTSW 2 82,805,203 (GRCm39) missense probably damaging 0.96
R4739:Fsip2 UTSW 2 82,805,697 (GRCm39) missense possibly damaging 0.92
R4749:Fsip2 UTSW 2 82,819,629 (GRCm39) missense probably benign 0.06
R4791:Fsip2 UTSW 2 82,812,452 (GRCm39) missense possibly damaging 0.53
R4793:Fsip2 UTSW 2 82,818,044 (GRCm39) nonsense probably null
R4819:Fsip2 UTSW 2 82,818,786 (GRCm39) missense probably benign 0.06
R4832:Fsip2 UTSW 2 82,820,515 (GRCm39) missense possibly damaging 0.92
R4840:Fsip2 UTSW 2 82,815,815 (GRCm39) missense probably benign 0.26
R4840:Fsip2 UTSW 2 82,779,739 (GRCm39) missense probably benign 0.01
R4865:Fsip2 UTSW 2 82,821,295 (GRCm39) missense possibly damaging 0.86
R4876:Fsip2 UTSW 2 82,805,202 (GRCm39) missense possibly damaging 0.91
R4885:Fsip2 UTSW 2 82,818,438 (GRCm39) missense probably benign 0.02
R4911:Fsip2 UTSW 2 82,811,837 (GRCm39) missense possibly damaging 0.85
R4918:Fsip2 UTSW 2 82,824,114 (GRCm39) missense possibly damaging 0.51
R4936:Fsip2 UTSW 2 82,815,384 (GRCm39) missense probably benign 0.18
R4950:Fsip2 UTSW 2 82,807,758 (GRCm39) missense probably benign 0.03
R4950:Fsip2 UTSW 2 82,777,276 (GRCm39) missense probably damaging 0.97
R4959:Fsip2 UTSW 2 82,815,169 (GRCm39) missense probably benign 0.00
R4971:Fsip2 UTSW 2 82,816,222 (GRCm39) missense probably benign 0.38
R4973:Fsip2 UTSW 2 82,815,169 (GRCm39) missense probably benign 0.00
R4976:Fsip2 UTSW 2 82,818,535 (GRCm39) missense probably damaging 0.99
R5022:Fsip2 UTSW 2 82,809,773 (GRCm39) missense probably benign 0.33
R5027:Fsip2 UTSW 2 82,819,477 (GRCm39) missense possibly damaging 0.71
R5030:Fsip2 UTSW 2 82,818,836 (GRCm39) missense possibly damaging 0.85
R5048:Fsip2 UTSW 2 82,823,494 (GRCm39) missense probably damaging 0.97
R5096:Fsip2 UTSW 2 82,821,460 (GRCm39) missense probably benign 0.00
R5097:Fsip2 UTSW 2 82,822,329 (GRCm39) missense probably benign
R5119:Fsip2 UTSW 2 82,818,535 (GRCm39) missense probably damaging 0.99
R5138:Fsip2 UTSW 2 82,811,768 (GRCm39) missense probably benign 0.12
R5152:Fsip2 UTSW 2 82,808,916 (GRCm39) missense probably benign 0.43
R5174:Fsip2 UTSW 2 82,811,085 (GRCm39) missense probably benign 0.07
R5193:Fsip2 UTSW 2 82,813,338 (GRCm39) missense possibly damaging 0.53
R5245:Fsip2 UTSW 2 82,823,505 (GRCm39) missense probably benign 0.02
R5282:Fsip2 UTSW 2 82,808,925 (GRCm39) missense possibly damaging 0.61
R5323:Fsip2 UTSW 2 82,818,489 (GRCm39) missense possibly damaging 0.71
R5326:Fsip2 UTSW 2 82,812,207 (GRCm39) missense possibly damaging 0.84
R5378:Fsip2 UTSW 2 82,820,185 (GRCm39) missense possibly damaging 0.71
R5380:Fsip2 UTSW 2 82,805,742 (GRCm39) missense possibly damaging 0.91
R5396:Fsip2 UTSW 2 82,821,262 (GRCm39) missense probably benign 0.00
R5422:Fsip2 UTSW 2 82,812,572 (GRCm39) missense probably benign 0.00
R5481:Fsip2 UTSW 2 82,810,230 (GRCm39) missense probably benign 0.26
R5482:Fsip2 UTSW 2 82,815,654 (GRCm39) missense possibly damaging 0.80
R5513:Fsip2 UTSW 2 82,815,542 (GRCm39) missense possibly damaging 0.72
R5513:Fsip2 UTSW 2 82,781,256 (GRCm39) missense probably benign 0.07
R5513:Fsip2 UTSW 2 82,781,252 (GRCm39) missense probably damaging 1.00
R5536:Fsip2 UTSW 2 82,817,403 (GRCm39) missense probably benign 0.25
R5542:Fsip2 UTSW 2 82,812,207 (GRCm39) missense possibly damaging 0.84
R5553:Fsip2 UTSW 2 82,793,090 (GRCm39) missense probably benign
R5568:Fsip2 UTSW 2 82,816,908 (GRCm39) missense probably benign 0.25
R5581:Fsip2 UTSW 2 82,828,472 (GRCm39) missense possibly damaging 0.84
R5664:Fsip2 UTSW 2 82,818,439 (GRCm39) missense probably benign 0.05
R5672:Fsip2 UTSW 2 82,817,838 (GRCm39) nonsense probably null
R5712:Fsip2 UTSW 2 82,839,192 (GRCm39) missense possibly damaging 0.73
R5762:Fsip2 UTSW 2 82,808,260 (GRCm39) missense probably benign 0.33
R5772:Fsip2 UTSW 2 82,815,084 (GRCm39) missense probably benign
R5881:Fsip2 UTSW 2 82,814,785 (GRCm39) missense possibly damaging 0.72
R5919:Fsip2 UTSW 2 82,822,953 (GRCm39) missense possibly damaging 0.71
R5920:Fsip2 UTSW 2 82,818,852 (GRCm39) nonsense probably null
R5934:Fsip2 UTSW 2 82,817,092 (GRCm39) missense possibly damaging 0.86
R5938:Fsip2 UTSW 2 82,807,835 (GRCm39) missense probably benign 0.00
R5974:Fsip2 UTSW 2 82,793,657 (GRCm39) missense possibly damaging 0.68
R5991:Fsip2 UTSW 2 82,820,812 (GRCm39) missense probably benign 0.28
R6019:Fsip2 UTSW 2 82,818,283 (GRCm39) missense possibly damaging 0.52
R6020:Fsip2 UTSW 2 82,822,471 (GRCm39) missense probably damaging 0.99
R6056:Fsip2 UTSW 2 82,816,017 (GRCm39) missense probably benign 0.01
R6057:Fsip2 UTSW 2 82,809,777 (GRCm39) missense probably damaging 0.99
R6139:Fsip2 UTSW 2 82,821,388 (GRCm39) missense possibly damaging 0.85
R6145:Fsip2 UTSW 2 82,824,112 (GRCm39) missense possibly damaging 0.71
R6160:Fsip2 UTSW 2 82,818,289 (GRCm39) nonsense probably null
R6161:Fsip2 UTSW 2 82,817,601 (GRCm39) missense possibly damaging 0.80
R6166:Fsip2 UTSW 2 82,811,071 (GRCm39) missense probably benign 0.00
R6187:Fsip2 UTSW 2 82,812,798 (GRCm39) missense probably benign 0.33
R6196:Fsip2 UTSW 2 82,820,227 (GRCm39) missense possibly damaging 0.71
R6217:Fsip2 UTSW 2 82,818,762 (GRCm39) missense possibly damaging 0.93
R6276:Fsip2 UTSW 2 82,810,785 (GRCm39) missense possibly damaging 0.91
R6278:Fsip2 UTSW 2 82,819,242 (GRCm39) missense probably benign 0.16
R6349:Fsip2 UTSW 2 82,823,416 (GRCm39) missense probably benign 0.05
R6351:Fsip2 UTSW 2 82,823,028 (GRCm39) missense possibly damaging 0.51
R6401:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6404:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6405:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6437:Fsip2 UTSW 2 82,813,836 (GRCm39) missense possibly damaging 0.73
R6478:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6479:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6480:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6481:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6521:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6529:Fsip2 UTSW 2 82,812,657 (GRCm39) missense probably benign
R6621:Fsip2 UTSW 2 82,820,158 (GRCm39) missense possibly damaging 0.93
R6639:Fsip2 UTSW 2 82,813,571 (GRCm39) missense possibly damaging 0.85
R6649:Fsip2 UTSW 2 82,798,161 (GRCm39) missense possibly damaging 0.83
R6714:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6714:Fsip2 UTSW 2 82,809,878 (GRCm39) missense probably benign 0.01
R6749:Fsip2 UTSW 2 82,808,738 (GRCm39) missense possibly damaging 0.85
R6765:Fsip2 UTSW 2 82,816,776 (GRCm39) missense probably benign
R6790:Fsip2 UTSW 2 82,821,283 (GRCm39) missense possibly damaging 0.53
R6793:Fsip2 UTSW 2 82,819,838 (GRCm39) missense probably benign 0.43
R6795:Fsip2 UTSW 2 82,811,303 (GRCm39) missense probably benign 0.08
R6818:Fsip2 UTSW 2 82,815,544 (GRCm39) missense probably benign 0.04
R6844:Fsip2 UTSW 2 82,813,969 (GRCm39) missense possibly damaging 0.72
R6848:Fsip2 UTSW 2 82,813,131 (GRCm39) missense probably benign 0.26
R6945:Fsip2 UTSW 2 82,823,184 (GRCm39) missense probably benign 0.16
R6950:Fsip2 UTSW 2 82,816,332 (GRCm39) missense probably benign 0.03
R6951:Fsip2 UTSW 2 82,812,293 (GRCm39) missense possibly damaging 0.68
R6974:Fsip2 UTSW 2 82,809,061 (GRCm39) missense probably damaging 0.96
R6987:Fsip2 UTSW 2 82,778,630 (GRCm39) nonsense probably null
R6989:Fsip2 UTSW 2 82,807,298 (GRCm39) missense probably benign 0.00
R7001:Fsip2 UTSW 2 82,817,269 (GRCm39) missense probably damaging 1.00
R7002:Fsip2 UTSW 2 82,819,687 (GRCm39) missense possibly damaging 0.86
R7016:Fsip2 UTSW 2 82,820,979 (GRCm39) missense probably benign 0.25
R7066:Fsip2 UTSW 2 82,821,235 (GRCm39) missense possibly damaging 0.86
R7067:Fsip2 UTSW 2 82,811,078 (GRCm39) missense possibly damaging 0.85
R7077:Fsip2 UTSW 2 82,813,496 (GRCm39) missense probably benign 0.18
R7099:Fsip2 UTSW 2 82,817,968 (GRCm39) missense probably benign
R7126:Fsip2 UTSW 2 82,813,485 (GRCm39) missense possibly damaging 0.53
R7156:Fsip2 UTSW 2 82,813,085 (GRCm39) missense probably benign 0.00
R7165:Fsip2 UTSW 2 82,811,541 (GRCm39) missense possibly damaging 0.77
R7171:Fsip2 UTSW 2 82,816,571 (GRCm39) nonsense probably null
R7189:Fsip2 UTSW 2 82,823,581 (GRCm39) missense possibly damaging 0.92
R7217:Fsip2 UTSW 2 82,819,412 (GRCm39) missense possibly damaging 0.85
R7222:Fsip2 UTSW 2 82,814,015 (GRCm39) missense probably benign
R7228:Fsip2 UTSW 2 82,822,651 (GRCm39) missense possibly damaging 0.93
R7238:Fsip2 UTSW 2 82,812,484 (GRCm39) missense possibly damaging 0.72
R7244:Fsip2 UTSW 2 82,823,607 (GRCm39) missense possibly damaging 0.92
R7251:Fsip2 UTSW 2 82,809,425 (GRCm39) missense possibly damaging 0.95
R7259:Fsip2 UTSW 2 82,812,474 (GRCm39) missense possibly damaging 0.85
R7291:Fsip2 UTSW 2 82,810,863 (GRCm39) missense possibly damaging 0.91
R7316:Fsip2 UTSW 2 82,820,035 (GRCm39) missense possibly damaging 0.93
R7323:Fsip2 UTSW 2 82,819,860 (GRCm39) missense probably benign 0.07
R7335:Fsip2 UTSW 2 82,813,462 (GRCm39) missense probably benign
R7343:Fsip2 UTSW 2 82,809,711 (GRCm39) missense probably benign 0.07
R7346:Fsip2 UTSW 2 82,828,524 (GRCm39) missense probably benign 0.00
R7389:Fsip2 UTSW 2 82,819,140 (GRCm39) missense possibly damaging 0.51
R7391:Fsip2 UTSW 2 82,820,663 (GRCm39) missense possibly damaging 0.70
R7397:Fsip2 UTSW 2 82,815,601 (GRCm39) missense possibly damaging 0.53
R7426:Fsip2 UTSW 2 82,810,441 (GRCm39) missense probably damaging 0.98
R7450:Fsip2 UTSW 2 82,782,024 (GRCm39) missense probably benign 0.30
R7538:Fsip2 UTSW 2 82,818,894 (GRCm39) missense possibly damaging 0.86
R7542:Fsip2 UTSW 2 82,815,196 (GRCm39) missense possibly damaging 0.96
R7549:Fsip2 UTSW 2 82,824,337 (GRCm39) missense probably damaging 0.99
R7564:Fsip2 UTSW 2 82,819,361 (GRCm39) missense probably benign 0.02
R7565:Fsip2 UTSW 2 82,779,856 (GRCm39) missense probably damaging 0.97
R7583:Fsip2 UTSW 2 82,805,585 (GRCm39) missense probably benign 0.12
R7641:Fsip2 UTSW 2 82,817,256 (GRCm39) nonsense probably null
R7655:Fsip2 UTSW 2 82,807,886 (GRCm39) missense possibly damaging 0.91
R7656:Fsip2 UTSW 2 82,807,886 (GRCm39) missense possibly damaging 0.91
R7665:Fsip2 UTSW 2 82,812,149 (GRCm39) missense probably benign 0.03
R7672:Fsip2 UTSW 2 82,820,455 (GRCm39) missense possibly damaging 0.93
R7764:Fsip2 UTSW 2 82,811,252 (GRCm39) missense possibly damaging 0.93
R7790:Fsip2 UTSW 2 82,818,723 (GRCm39) missense probably benign
R7811:Fsip2 UTSW 2 82,828,797 (GRCm39) missense possibly damaging 0.93
R7838:Fsip2 UTSW 2 82,807,044 (GRCm39) missense probably benign 0.00
R7873:Fsip2 UTSW 2 82,779,856 (GRCm39) missense probably damaging 0.97
R7902:Fsip2 UTSW 2 82,808,168 (GRCm39) missense possibly damaging 0.72
R7920:Fsip2 UTSW 2 82,781,365 (GRCm39) missense possibly damaging 0.94
R7959:Fsip2 UTSW 2 82,816,120 (GRCm39) missense possibly damaging 0.51
R8009:Fsip2 UTSW 2 82,818,793 (GRCm39) missense possibly damaging 0.85
R8031:Fsip2 UTSW 2 82,817,235 (GRCm39) missense probably benign
R8034:Fsip2 UTSW 2 82,819,699 (GRCm39) missense possibly damaging 0.92
R8037:Fsip2 UTSW 2 82,816,322 (GRCm39) missense possibly damaging 0.72
R8110:Fsip2 UTSW 2 82,789,017 (GRCm39) missense probably benign 0.00
R8117:Fsip2 UTSW 2 82,823,296 (GRCm39) missense possibly damaging 0.86
R8138:Fsip2 UTSW 2 82,806,141 (GRCm39) missense possibly damaging 0.83
R8175:Fsip2 UTSW 2 82,818,021 (GRCm39) missense probably benign 0.16
R8175:Fsip2 UTSW 2 82,815,088 (GRCm39) missense probably benign 0.06
R8182:Fsip2 UTSW 2 82,806,951 (GRCm39) missense probably damaging 0.99
R8206:Fsip2 UTSW 2 82,820,808 (GRCm39) missense possibly damaging 0.85
R8229:Fsip2 UTSW 2 82,808,487 (GRCm39) missense possibly damaging 0.63
R8239:Fsip2 UTSW 2 82,819,687 (GRCm39) missense possibly damaging 0.71
R8245:Fsip2 UTSW 2 82,811,346 (GRCm39) missense possibly damaging 0.79
R8303:Fsip2 UTSW 2 82,818,724 (GRCm39) missense probably benign 0.00
R8336:Fsip2 UTSW 2 82,821,099 (GRCm39) missense possibly damaging 0.53
R8347:Fsip2 UTSW 2 82,818,198 (GRCm39) missense probably benign 0.16
R8351:Fsip2 UTSW 2 82,822,239 (GRCm39) missense possibly damaging 0.73
R8352:Fsip2 UTSW 2 82,814,937 (GRCm39) missense probably benign
R8419:Fsip2 UTSW 2 82,808,963 (GRCm39) missense probably damaging 0.96
R8431:Fsip2 UTSW 2 82,811,910 (GRCm39) missense probably damaging 1.00
R8439:Fsip2 UTSW 2 82,807,430 (GRCm39) missense probably benign 0.24
R8452:Fsip2 UTSW 2 82,814,937 (GRCm39) missense probably benign
R8459:Fsip2 UTSW 2 82,810,022 (GRCm39) missense possibly damaging 0.95
R8465:Fsip2 UTSW 2 82,810,284 (GRCm39) missense probably benign 0.26
R8473:Fsip2 UTSW 2 82,777,336 (GRCm39) missense probably damaging 0.99
R8703:Fsip2 UTSW 2 82,821,871 (GRCm39) missense probably damaging 0.98
R8711:Fsip2 UTSW 2 82,815,246 (GRCm39) missense possibly damaging 0.53
R8713:Fsip2 UTSW 2 82,811,453 (GRCm39) missense probably damaging 1.00
R8789:Fsip2 UTSW 2 82,815,822 (GRCm39) missense possibly damaging 0.73
R8805:Fsip2 UTSW 2 82,813,453 (GRCm39) missense possibly damaging 0.46
R8840:Fsip2 UTSW 2 82,821,606 (GRCm39) missense probably benign 0.03
R8855:Fsip2 UTSW 2 82,810,521 (GRCm39) missense probably benign 0.04
R8866:Fsip2 UTSW 2 82,810,521 (GRCm39) missense probably benign 0.04
R8875:Fsip2 UTSW 2 82,820,782 (GRCm39) missense possibly damaging 0.95
R8883:Fsip2 UTSW 2 82,809,524 (GRCm39) missense possibly damaging 0.68
R8903:Fsip2 UTSW 2 82,807,681 (GRCm39) missense possibly damaging 0.83
R8907:Fsip2 UTSW 2 82,816,984 (GRCm39) missense probably benign 0.20
R8912:Fsip2 UTSW 2 82,810,938 (GRCm39) missense probably benign
R8926:Fsip2 UTSW 2 82,823,927 (GRCm39) missense possibly damaging 0.84
R8991:Fsip2 UTSW 2 82,815,370 (GRCm39) missense probably benign 0.33
R9014:Fsip2 UTSW 2 82,806,898 (GRCm39) missense probably benign 0.32
R9014:Fsip2 UTSW 2 82,817,075 (GRCm39) missense possibly damaging 0.71
R9039:Fsip2 UTSW 2 82,828,545 (GRCm39) missense probably benign 0.32
R9054:Fsip2 UTSW 2 82,806,180 (GRCm39) missense possibly damaging 0.68
R9114:Fsip2 UTSW 2 82,807,301 (GRCm39) missense probably benign 0.00
R9124:Fsip2 UTSW 2 82,816,103 (GRCm39) missense probably benign 0.00
R9131:Fsip2 UTSW 2 82,813,170 (GRCm39) missense probably benign
R9149:Fsip2 UTSW 2 82,812,374 (GRCm39) missense possibly damaging 0.86
R9180:Fsip2 UTSW 2 82,815,574 (GRCm39) missense possibly damaging 0.96
R9192:Fsip2 UTSW 2 82,817,844 (GRCm39) missense probably benign 0.06
R9216:Fsip2 UTSW 2 82,820,425 (GRCm39) missense probably damaging 0.99
R9218:Fsip2 UTSW 2 82,823,062 (GRCm39) missense probably damaging 0.97
R9222:Fsip2 UTSW 2 82,815,958 (GRCm39) missense probably benign 0.00
R9262:Fsip2 UTSW 2 82,807,662 (GRCm39) missense probably benign 0.00
R9340:Fsip2 UTSW 2 82,818,604 (GRCm39) missense possibly damaging 0.71
R9342:Fsip2 UTSW 2 82,818,747 (GRCm39) missense possibly damaging 0.71
R9368:Fsip2 UTSW 2 82,811,039 (GRCm39) missense possibly damaging 0.68
R9372:Fsip2 UTSW 2 82,822,756 (GRCm39) missense possibly damaging 0.71
R9385:Fsip2 UTSW 2 82,819,793 (GRCm39) missense possibly damaging 0.84
R9432:Fsip2 UTSW 2 82,805,907 (GRCm39) missense probably damaging 0.98
R9434:Fsip2 UTSW 2 82,816,702 (GRCm39) missense possibly damaging 0.71
R9445:Fsip2 UTSW 2 82,806,132 (GRCm39) missense probably damaging 0.99
R9472:Fsip2 UTSW 2 82,817,285 (GRCm39) missense possibly damaging 0.85
R9496:Fsip2 UTSW 2 82,793,062 (GRCm39) missense probably benign
R9523:Fsip2 UTSW 2 82,807,972 (GRCm39) missense probably damaging 0.99
R9567:Fsip2 UTSW 2 82,798,173 (GRCm39) missense probably benign
R9636:Fsip2 UTSW 2 82,820,563 (GRCm39) missense possibly damaging 0.52
R9643:Fsip2 UTSW 2 82,821,984 (GRCm39) missense possibly damaging 0.53
R9680:Fsip2 UTSW 2 82,819,272 (GRCm39) missense probably benign 0.32
R9695:Fsip2 UTSW 2 82,806,226 (GRCm39) missense probably benign
R9705:Fsip2 UTSW 2 82,823,634 (GRCm39) missense probably benign
R9739:Fsip2 UTSW 2 82,823,896 (GRCm39) missense possibly damaging 0.71
R9751:Fsip2 UTSW 2 82,818,241 (GRCm39) missense probably benign 0.00
R9761:Fsip2 UTSW 2 82,821,994 (GRCm39) missense probably benign 0.00
R9798:Fsip2 UTSW 2 82,810,225 (GRCm39) nonsense probably null
RF003:Fsip2 UTSW 2 82,821,865 (GRCm39) missense probably benign 0.02
RF005:Fsip2 UTSW 2 82,822,876 (GRCm39) missense probably benign 0.04
RF008:Fsip2 UTSW 2 82,808,184 (GRCm39) missense probably benign
RF028:Fsip2 UTSW 2 82,824,352 (GRCm39) frame shift probably null
RF029:Fsip2 UTSW 2 82,824,352 (GRCm39) frame shift probably null
RF036:Fsip2 UTSW 2 82,814,707 (GRCm39) critical splice acceptor site probably benign
RF038:Fsip2 UTSW 2 82,824,352 (GRCm39) frame shift probably null
RF062:Fsip2 UTSW 2 82,814,707 (GRCm39) critical splice acceptor site probably benign
X0018:Fsip2 UTSW 2 82,812,851 (GRCm39) nonsense probably null
X0020:Fsip2 UTSW 2 82,781,364 (GRCm39) missense probably damaging 1.00
X0025:Fsip2 UTSW 2 82,785,290 (GRCm39) missense possibly damaging 0.70
X0027:Fsip2 UTSW 2 82,807,122 (GRCm39) missense probably benign 0.35
X0066:Fsip2 UTSW 2 82,817,807 (GRCm39) missense possibly damaging 0.51
Z1088:Fsip2 UTSW 2 82,818,978 (GRCm39) missense possibly damaging 0.85
Z1088:Fsip2 UTSW 2 82,817,997 (GRCm39) missense possibly damaging 0.86
Z1088:Fsip2 UTSW 2 82,805,792 (GRCm39) missense probably damaging 0.96
Z1176:Fsip2 UTSW 2 82,820,009 (GRCm39) missense probably benign 0.02
Z1177:Fsip2 UTSW 2 82,814,868 (GRCm39) missense probably damaging 0.98
Z1177:Fsip2 UTSW 2 82,777,304 (GRCm39) missense probably damaging 0.99
Z1177:Fsip2 UTSW 2 82,817,547 (GRCm39) missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TCAGTGGCTCAAACCTGCAAGAAG -3'
(R):5'- TGAACTCATCAACATCATCTGGCCC -3'

Sequencing Primer
(F):5'- CACTAAGCAAAGGGAGTTGTCATTC -3'
(R):5'- TCCTTCAAGATGACATTGAGGAC -3'
Posted On 2013-07-11