Incidental Mutation 'R7201:D17Wsu92e'
ID574653
Institutional Source Beutler Lab
Gene Symbol D17Wsu92e
Ensembl Gene ENSMUSG00000056692
Gene NameDNA segment, Chr 17, Wayne State University 92, expressed
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7201 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location27751232-27820558 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 27794070 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075076] [ENSMUST00000075076] [ENSMUST00000114859] [ENSMUST00000114859] [ENSMUST00000114863] [ENSMUST00000114863]
Predicted Effect probably null
Transcript: ENSMUST00000075076
SMART Domains Protein: ENSMUSP00000074585
Gene: ENSMUSG00000056692

DomainStartEndE-ValueType
Pfam:UBA_4 25 68 1.6e-13 PFAM
Pfam:N_BRCA1_IG 80 179 1.6e-37 PFAM
low complexity region 257 276 N/A INTRINSIC
low complexity region 282 291 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000075076
SMART Domains Protein: ENSMUSP00000074585
Gene: ENSMUSG00000056692

DomainStartEndE-ValueType
Pfam:UBA_4 25 68 1.6e-13 PFAM
Pfam:N_BRCA1_IG 80 179 1.6e-37 PFAM
low complexity region 257 276 N/A INTRINSIC
low complexity region 282 291 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114859
SMART Domains Protein: ENSMUSP00000110509
Gene: ENSMUSG00000056692

DomainStartEndE-ValueType
Pfam:UBA_4 25 69 5.1e-15 PFAM
PDB:4OLE|D 74 180 2e-9 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114859
SMART Domains Protein: ENSMUSP00000110509
Gene: ENSMUSG00000056692

DomainStartEndE-ValueType
Pfam:UBA_4 25 69 5.1e-15 PFAM
PDB:4OLE|D 74 180 2e-9 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114863
SMART Domains Protein: ENSMUSP00000110513
Gene: ENSMUSG00000056692

DomainStartEndE-ValueType
Pfam:UBA_4 25 69 2.2e-14 PFAM
PDB:4OLE|D 74 180 8e-9 PDB
low complexity region 257 276 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114863
SMART Domains Protein: ENSMUSP00000110513
Gene: ENSMUSG00000056692

DomainStartEndE-ValueType
Pfam:UBA_4 25 69 2.2e-14 PFAM
PDB:4OLE|D 74 180 8e-9 PDB
low complexity region 257 276 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,291,627 M1850V probably benign Het
4933406M09Rik A G 1: 134,390,468 D326G possibly damaging Het
Acaca A G 11: 84,262,474 T903A probably benign Het
Acin1 A T 14: 54,664,899 S479T possibly damaging Het
Actr6 A T 10: 89,712,512 D370E probably benign Het
Adgrl3 T C 5: 81,724,222 F921S probably damaging Het
Ankmy1 A T 1: 92,886,824 H320Q possibly damaging Het
Arhgef5 C T 6: 43,273,232 Q306* probably null Het
Arntl T A 7: 113,285,142 M122K probably damaging Het
Art4 A T 6: 136,854,549 V198E probably benign Het
Asph G A 4: 9,474,917 R686W probably damaging Het
Atg7 A G 6: 114,777,057 H724R probably damaging Het
B020004J07Rik T A 4: 101,838,141 probably null Het
BC034090 A G 1: 155,241,934 V146A probably damaging Het
Bcl2a1d T A 9: 88,731,586 Q45L probably damaging Het
Ccdc36 A T 9: 108,404,775 D571E probably damaging Het
Cd28 G T 1: 60,763,173 E84* probably null Het
Ceacam3 G A 7: 17,158,238 W302* probably null Het
Cerkl T C 2: 79,333,590 N462S probably benign Het
Cisd2 A T 3: 135,411,213 L39H probably damaging Het
Col11a1 C A 3: 114,090,157 T225K unknown Het
Col15a1 A T 4: 47,307,752 Y1178F possibly damaging Het
Cul4a T C 8: 13,142,991 S630P probably damaging Het
Cyp2c38 T A 19: 39,401,776 I327F probably damaging Het
Cyp3a25 A C 5: 145,991,447 S263A probably benign Het
Cyp3a25 T A 5: 146,003,058 L46F probably benign Het
Dmrta1 T A 4: 89,692,171 L456* probably null Het
Dnah12 T C 14: 26,814,622 L2165P probably benign Het
Dsg1a C A 18: 20,328,311 S253R probably damaging Het
Egln2 A C 7: 27,160,319 I323S probably damaging Het
Fam171b A G 2: 83,878,230 T359A probably damaging Het
Fcgr2b G T 1: 170,963,397 Q276K probably benign Het
Fcrls C T 3: 87,252,627 C440Y probably damaging Het
Fmnl2 T C 2: 53,073,654 V266A unknown Het
Glo1 A T 17: 30,597,854 D109E probably benign Het
Grin3b A G 10: 79,974,078 R473G possibly damaging Het
Ica1 G A 6: 8,644,015 L425F probably damaging Het
Kcnq5 T C 1: 21,402,875 E716G possibly damaging Het
Klra17 A T 6: 129,873,343 I48K possibly damaging Het
Lrrc66 G T 5: 73,629,897 Q37K probably benign Het
Ly6a T A 15: 74,996,476 T55S probably benign Het
Lyst T A 13: 13,709,300 Y2924* probably null Het
Lyzl6 A G 11: 103,631,351 Y140H probably benign Het
Mak T C 13: 41,051,440 I141V possibly damaging Het
Mapk7 A G 11: 61,489,172 I789T probably benign Het
Mrpl4 T C 9: 21,007,338 I123T probably benign Het
Mup18 G C 4: 61,673,336 probably null Het
Myef2 T C 2: 125,096,162 probably null Het
Myh7 T C 14: 54,990,945 T235A possibly damaging Het
Myo18b C T 5: 112,715,459 C2171Y probably damaging Het
Nat8 A T 6: 85,830,895 Y85* probably null Het
Nyap1 A T 5: 137,736,262 S170T probably damaging Het
Ogfr AGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,094 probably benign Het
Olfr392 A G 11: 73,814,341 V247A probably benign Het
Olfr559 T A 7: 102,724,485 I2F probably benign Het
Olfr718-ps1 A G 5: 143,137,798 Y157H probably damaging Het
Papss1 T C 3: 131,599,926 L244P probably damaging Het
Pibf1 A T 14: 99,196,408 D597V probably damaging Het
Pmpcb T A 5: 21,737,179 M1K probably null Het
Ppwd1 G A 13: 104,207,172 P575L probably damaging Het
Prc1 A G 7: 80,311,089 Q457R possibly damaging Het
Prdm10 T C 9: 31,316,306 V69A possibly damaging Het
Prkdc A G 16: 15,698,803 I1014V probably benign Het
Rab3gap2 A G 1: 185,267,191 Y999C probably damaging Het
Robo3 G A 9: 37,424,330 Q539* probably null Het
Rps12 A G 10: 23,785,231 Y127H probably benign Het
Sar1b A G 11: 51,788,252 D116G probably benign Het
Selenbp2 C T 3: 94,702,357 P294L probably benign Het
Slc6a2 T C 8: 92,995,672 Y516H probably damaging Het
Slit2 A G 5: 48,237,285 N673S probably null Het
Snap91 A T 9: 86,790,146 probably null Het
Srpk2 A G 5: 23,507,628 F653L possibly damaging Het
Supt5 A T 7: 28,316,788 S824T probably benign Het
Taar7a A G 10: 23,992,460 V341A probably benign Het
Tmem52 G A 4: 155,470,321 G134R probably damaging Het
Ush2a A G 1: 188,874,754 T3949A probably benign Het
Usp32 GAACAAGTCCACAACAA GAACAA 11: 85,022,855 probably null Het
Vmn1r173 A T 7: 23,702,158 probably benign Het
Vmn2r118 G A 17: 55,608,496 R485* probably null Het
Vwce A G 19: 10,638,115 E120G possibly damaging Het
Zfp143 T C 7: 110,093,080 V566A possibly damaging Het
Other mutations in D17Wsu92e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:D17Wsu92e APN 17 27767919 missense probably damaging 1.00
IGL01107:D17Wsu92e APN 17 27786069 critical splice donor site probably null
IGL01805:D17Wsu92e APN 17 27767906 splice site probably benign
detroit UTSW 17 27794070 splice site probably null
michigander UTSW 17 27767986 missense probably benign 0.12
R0423:D17Wsu92e UTSW 17 27786233 missense probably damaging 1.00
R0833:D17Wsu92e UTSW 17 27786138 missense probably damaging 1.00
R0836:D17Wsu92e UTSW 17 27786138 missense probably damaging 1.00
R1055:D17Wsu92e UTSW 17 27767936 missense probably damaging 1.00
R1251:D17Wsu92e UTSW 17 27786070 critical splice donor site probably null
R1646:D17Wsu92e UTSW 17 27793960 missense probably damaging 1.00
R4022:D17Wsu92e UTSW 17 27786262 missense probably damaging 0.97
R4604:D17Wsu92e UTSW 17 27820315 missense probably damaging 1.00
R5360:D17Wsu92e UTSW 17 27794046 missense probably damaging 1.00
R6210:D17Wsu92e UTSW 17 27767986 missense probably benign 0.12
R7994:D17Wsu92e UTSW 17 27767943 missense probably benign
R8057:D17Wsu92e UTSW 17 27767889 missense unknown
R8767:D17Wsu92e UTSW 17 27768069 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCATGCCCTTCTCAGTCTAAC -3'
(R):5'- CTGCCTTCAGGAGAAAATGGC -3'

Sequencing Primer
(F):5'- GCCCTTCTCAGTCTAACTTTAAAAC -3'
(R):5'- CTTCAGGAGAAAATGGCACAAGTTTG -3'
Posted On2019-09-27