Incidental Mutation 'R7225:Ube2j2'
ID574655
Institutional Source Beutler Lab
Gene Symbol Ube2j2
Ensembl Gene ENSMUSG00000023286
Gene Nameubiquitin-conjugating enzyme E2J 2
Synonyms1200007B18Rik, Ubc6, 5730472G04Rik, 2400008G19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7225 (G1)
Quality Score104.008
Status Validated
Chromosome4
Chromosomal Location155943831-155959604 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 155949316 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024056] [ENSMUST00000103175] [ENSMUST00000105581] [ENSMUST00000105582] [ENSMUST00000105583] [ENSMUST00000118192] [ENSMUST00000136492] [ENSMUST00000152536] [ENSMUST00000166489]
AlphaFold Q6P073
Predicted Effect probably benign
Transcript: ENSMUST00000024056
SMART Domains Protein: ENSMUSP00000024056
Gene: ENSMUSG00000023286

DomainStartEndE-ValueType
UBCc 27 181 3.22e-31 SMART
low complexity region 218 234 N/A INTRINSIC
Blast:UBCc 235 270 7e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000103175
SMART Domains Protein: ENSMUSP00000099464
Gene: ENSMUSG00000023286

DomainStartEndE-ValueType
UBCc 15 169 3.22e-31 SMART
low complexity region 206 222 N/A INTRINSIC
Blast:UBCc 223 258 7e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105581
SMART Domains Protein: ENSMUSP00000101206
Gene: ENSMUSG00000023286

DomainStartEndE-ValueType
UBCc 15 169 3.22e-31 SMART
low complexity region 206 222 N/A INTRINSIC
Blast:UBCc 223 258 7e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105582
SMART Domains Protein: ENSMUSP00000101207
Gene: ENSMUSG00000023286

DomainStartEndE-ValueType
UBCc 27 181 3.22e-31 SMART
low complexity region 218 234 N/A INTRINSIC
Blast:UBCc 235 270 7e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105583
SMART Domains Protein: ENSMUSP00000101208
Gene: ENSMUSG00000023286

DomainStartEndE-ValueType
UBCc 27 181 3.22e-31 SMART
low complexity region 218 234 N/A INTRINSIC
Blast:UBCc 235 270 7e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000118192
SMART Domains Protein: ENSMUSP00000112785
Gene: ENSMUSG00000023286

DomainStartEndE-ValueType
UBCc 15 153 5.28e-27 SMART
low complexity region 179 195 N/A INTRINSIC
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136492
Predicted Effect probably null
Transcript: ENSMUST00000152536
SMART Domains Protein: ENSMUSP00000114235
Gene: ENSMUSG00000023286

DomainStartEndE-ValueType
UBCc 2 117 5.4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166489
SMART Domains Protein: ENSMUSP00000127712
Gene: ENSMUSG00000023286

DomainStartEndE-ValueType
UBCc 15 169 3.22e-31 SMART
low complexity region 206 222 N/A INTRINSIC
Blast:UBCc 223 258 7e-6 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is located in the membrane of the endoplasmic reticulum. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik T C 12: 110,670,865 probably benign Het
5430403G16Rik T C 5: 109,677,149 H145R possibly damaging Het
5730480H06Rik T A 5: 48,380,233 probably null Het
Actn4 A T 7: 28,898,699 V492D probably damaging Het
Alpk2 T C 18: 65,305,199 E1041G probably benign Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cd22 C T 7: 30,877,634 A83T not run Het
Cdan1 T C 2: 120,724,912 T783A probably benign Het
Cdh9 C T 15: 16,856,073 S733F probably damaging Het
Cfap54 A G 10: 92,904,374 F2282S unknown Het
Chst9 T C 18: 15,452,661 K282E probably damaging Het
Clcn1 G A 6: 42,293,462 D232N probably damaging Het
Clpb T A 7: 101,711,465 L234Q probably damaging Het
Cluh T G 11: 74,666,406 probably null Het
Cnp C T 11: 100,580,587 Q352* probably null Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Dtx3 C T 10: 127,191,489 C272Y probably damaging Het
Dync2h1 A G 9: 7,142,756 I1156T probably benign Het
Epg5 T A 18: 78,012,702 V1697E probably benign Het
Exoc3l4 A G 12: 111,423,624 D211G probably benign Het
Fank1 A G 7: 133,853,259 K36R probably benign Het
Fat4 T C 3: 38,980,176 I2659T possibly damaging Het
Fer1l5 T C 1: 36,420,952 W1893R possibly damaging Het
Gorasp2 T A 2: 70,684,047 L256Q probably damaging Het
Gpc5 T G 14: 115,552,298 V528G probably damaging Het
Gria2 T A 3: 80,802,631 probably benign Het
Htatip2 A G 7: 49,770,856 E150G possibly damaging Het
Jak3 C A 8: 71,685,511 Q869K probably benign Het
Jmjd1c T C 10: 67,226,065 V1218A probably benign Het
Kcnf1 A G 12: 17,175,693 C176R possibly damaging Het
Kcnq4 A G 4: 120,746,914 V88A probably benign Het
Lmod3 T A 6: 97,247,384 D492V probably benign Het
Lurap1l A C 4: 80,911,481 S43R probably benign Het
Mamdc4 T C 2: 25,565,546 H890R possibly damaging Het
Mertk T G 2: 128,801,562 N960K possibly damaging Het
Nudt9 C A 5: 104,065,100 D346E probably benign Het
Olfr1434 A T 19: 12,283,467 T140S probably benign Het
Opa1 A G 16: 29,614,039 probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Paxbp1 T C 16: 91,027,068 E564G probably damaging Het
Pcdhb13 C T 18: 37,444,437 R623C possibly damaging Het
Pkhd1l1 G T 15: 44,546,941 V2615F probably damaging Het
Plin3 T C 17: 56,286,541 T58A possibly damaging Het
Por A G 5: 135,732,587 D309G probably benign Het
Ppp2r5e T C 12: 75,468,579 K261R probably damaging Het
Ptpn18 C T 1: 34,472,846 T366I possibly damaging Het
Ptprz1 G A 6: 23,000,929 G1006E possibly damaging Het
Rnf219 T C 14: 104,479,858 T360A probably benign Het
Rpl12 C T 2: 32,961,897 probably benign Het
Rpsa T G 9: 120,131,156 F262V probably benign Het
Sh3pxd2a G T 19: 47,267,389 N991K probably damaging Het
Shank2 T A 7: 144,285,025 N19K probably benign Het
Sik1 T C 17: 31,854,300 T61A probably benign Het
Sipa1l3 A C 7: 29,399,428 V472G probably damaging Het
Sirt6 A G 10: 81,622,481 S313P probably benign Het
Slc12a7 A G 13: 73,763,962 probably benign Het
Sox13 A T 1: 133,387,124 V266E probably benign Het
Spag9 T C 11: 94,097,358 C833R probably damaging Het
Tcof1 T C 18: 60,828,448 T812A unknown Het
Tnfsf4 A G 1: 161,417,250 D170G possibly damaging Het
Tshz3 A G 7: 36,769,657 N357S probably damaging Het
Txk C T 5: 72,700,714 D418N probably damaging Het
Vmn2r84 G A 10: 130,386,683 P556L probably damaging Het
Zfp442 T C 2: 150,409,005 N326D probably benign Het
Other mutations in Ube2j2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00939:Ube2j2 APN 4 155956447 missense possibly damaging 0.79
IGL00951:Ube2j2 APN 4 155946377 intron probably benign
IGL00953:Ube2j2 APN 4 155946377 intron probably benign
IGL01732:Ube2j2 APN 4 155957331 missense probably damaging 1.00
IGL02709:Ube2j2 APN 4 155957331 missense probably damaging 1.00
R1903:Ube2j2 UTSW 4 155949026 missense probably benign 0.13
R4172:Ube2j2 UTSW 4 155949086 missense probably damaging 1.00
R4630:Ube2j2 UTSW 4 155955258 missense probably damaging 0.98
R4632:Ube2j2 UTSW 4 155955258 missense probably damaging 0.98
R4999:Ube2j2 UTSW 4 155946384 start codon destroyed probably null
R5000:Ube2j2 UTSW 4 155946384 start codon destroyed probably null
R5249:Ube2j2 UTSW 4 155949058 missense possibly damaging 0.85
R7436:Ube2j2 UTSW 4 155957331 missense probably damaging 1.00
R7688:Ube2j2 UTSW 4 155956428 missense probably damaging 0.98
R7995:Ube2j2 UTSW 4 155957338 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCTTACATCTGTGCAGAGC -3'
(R):5'- GGGTTCATCGTATCAATGTTGCAC -3'

Sequencing Primer
(F):5'- ACATCTGTGCAGAGCCCCTC -3'
(R):5'- GCACTAATGTTCCCAGGCTATAGAG -3'
Posted On2019-09-27